Incidental Mutation 'R6754:1700061G19Rik'
ID530976
Institutional Source Beutler Lab
Gene Symbol 1700061G19Rik
Ensembl Gene ENSMUSG00000024209
Gene NameRIKEN cDNA 1700061G19 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6754 (G1)
Quality Score219.009
Status Not validated
Chromosome17
Chromosomal Location56875477-56888904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56883358 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 352 (F352L)
Ref Sequence ENSEMBL: ENSMUSP00000025048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025048]
Predicted Effect probably damaging
Transcript: ENSMUST00000025048
AA Change: F352L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025048
Gene: ENSMUSG00000024209
AA Change: F352L

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:AMP-binding 80 554 6.5e-68 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 T C 19: 34,244,983 D246G probably damaging Het
Ank2 A G 3: 127,096,839 probably benign Het
Bmpr2 T A 1: 59,870,280 I971N probably damaging Het
C9 C A 15: 6,489,943 C8* probably null Het
Casp2 T A 6: 42,269,330 N207K probably damaging Het
Cd302 T G 2: 60,272,107 D56A probably benign Het
Cecr2 C T 6: 120,757,578 P605S probably damaging Het
Cep152 A G 2: 125,587,668 V723A probably damaging Het
Col17a1 C T 19: 47,650,721 probably null Het
Ctsk T C 3: 95,502,685 V168A probably damaging Het
Cyp2c54 A T 19: 40,071,560 N176K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
F5 A G 1: 164,193,763 D1269G probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Hivep2 G A 10: 14,129,638 G660D probably benign Het
Hspb3 A T 13: 113,663,152 I114K probably damaging Het
Itgb7 T G 15: 102,216,160 *807C probably null Het
Kbtbd2 A G 6: 56,779,254 V499A probably damaging Het
Lemd3 A T 10: 120,933,660 I589N probably damaging Het
Mettl13 T C 1: 162,548,123 Y45C probably damaging Het
Mllt6 C T 11: 97,674,447 T571I probably damaging Het
Mrvi1 G A 7: 110,929,512 P43S probably damaging Het
Nabp1 A G 1: 51,474,540 I99T probably damaging Het
Ndufa4 A G 6: 11,906,053 V33A probably benign Het
Nr1h5 A G 3: 102,949,597 S200P probably damaging Het
Ntsr1 G A 2: 180,542,683 R393H probably benign Het
Olfr115 T C 17: 37,610,155 N199D probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Pcdhb21 A T 18: 37,514,683 K288N probably benign Het
Pla2g6 T C 15: 79,306,310 N351D probably benign Het
Polg T C 7: 79,459,836 E411G probably damaging Het
Ppp1r32 A T 19: 10,477,089 Y328N probably damaging Het
Prdm11 A G 2: 93,013,792 L31P probably damaging Het
Rab27b G A 18: 69,996,103 T40I probably damaging Het
Rnf219 C T 14: 104,503,414 E191K probably damaging Het
Ruvbl2 T C 7: 45,428,758 D97G probably benign Het
Sema3a T C 5: 13,599,275 V664A possibly damaging Het
Sh2d3c T C 2: 32,754,530 S842P probably damaging Het
Spam1 A G 6: 24,796,316 T89A probably damaging Het
Stab1 C T 14: 31,141,081 G2187E probably benign Het
Tff2 C A 17: 31,144,233 A6S probably benign Het
Trim80 T C 11: 115,448,174 V610A probably damaging Het
Trp53bp1 A G 2: 121,270,576 V47A possibly damaging Het
Ufl1 G A 4: 25,267,796 Q292* probably null Het
Ulk1 A T 5: 110,790,393 V571E possibly damaging Het
Usp24 A T 4: 106,360,420 N447Y probably damaging Het
Vmn1r81 A T 7: 12,259,847 I278K probably damaging Het
Other mutations in 1700061G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:1700061G19Rik APN 17 56882203 nonsense probably null
IGL01833:1700061G19Rik APN 17 56881062 missense probably benign 0.02
IGL02420:1700061G19Rik APN 17 56880494 missense probably damaging 1.00
IGL02969:1700061G19Rik APN 17 56883751 missense probably damaging 1.00
IGL03054:1700061G19Rik UTSW 17 56886528 missense possibly damaging 0.67
R0197:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R0257:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0279:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0280:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0281:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0282:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0329:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0330:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0349:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0518:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0519:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0521:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0604:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0883:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R1561:1700061G19Rik UTSW 17 56877431 missense probably benign
R1779:1700061G19Rik UTSW 17 56885169 nonsense probably null
R2008:1700061G19Rik UTSW 17 56886478 missense probably benign 0.04
R2102:1700061G19Rik UTSW 17 56884949 nonsense probably null
R2247:1700061G19Rik UTSW 17 56877435 missense possibly damaging 0.83
R2484:1700061G19Rik UTSW 17 56882641 missense probably benign 0.00
R2917:1700061G19Rik UTSW 17 56885141 missense probably damaging 1.00
R3149:1700061G19Rik UTSW 17 56876348 missense probably benign
R3773:1700061G19Rik UTSW 17 56876262 start codon destroyed probably null 0.00
R4829:1700061G19Rik UTSW 17 56883500 splice site probably null
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4887:1700061G19Rik UTSW 17 56876324 missense possibly damaging 0.84
R5043:1700061G19Rik UTSW 17 56885198 missense probably damaging 1.00
R5112:1700061G19Rik UTSW 17 56877465 missense probably benign 0.03
R5161:1700061G19Rik UTSW 17 56882888 missense possibly damaging 0.84
R5214:1700061G19Rik UTSW 17 56886493 missense probably benign
R5287:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5403:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5779:1700061G19Rik UTSW 17 56881061 missense probably benign 0.02
R5997:1700061G19Rik UTSW 17 56876373 missense probably benign 0.02
R6198:1700061G19Rik UTSW 17 56882679 missense probably damaging 1.00
R6259:1700061G19Rik UTSW 17 56877513 missense probably benign 0.04
R6357:1700061G19Rik UTSW 17 56877591 critical splice donor site probably null
R6842:1700061G19Rik UTSW 17 56877432 missense probably benign 0.00
R7042:1700061G19Rik UTSW 17 56885098 missense possibly damaging 0.73
R7181:1700061G19Rik UTSW 17 56881037 missense probably benign 0.03
R7445:1700061G19Rik UTSW 17 56882973 missense possibly damaging 0.64
R7511:1700061G19Rik UTSW 17 56882954 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGGTGGGAATGGTCACTC -3'
(R):5'- AACCTGTGATCACTGCTCCC -3'

Sequencing Primer
(F):5'- AAGGGTGCGACATACTCCCTC -3'
(R):5'- TGATCACTGCTCCCGGGTC -3'
Posted On2018-08-01