Incidental Mutation 'R6755:Fhad1'
ID530997
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6755 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141964604 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 407 (E407G)
Ref Sequence ENSEMBL: ENSMUSP00000101406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably damaging
Transcript: ENSMUST00000105779
AA Change: E407G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: E407G

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105780
AA Change: E407G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: E407G

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123068
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141957658 missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141916067 splice site probably null
R5504_Fhad1_818 UTSW 4 141985535 missense probably benign
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
R8711:Fhad1 UTSW 4 141957613 missense probably benign 0.25
R8751:Fhad1 UTSW 4 141918823 missense probably benign 0.04
R8783:Fhad1 UTSW 4 141909092 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACATTGTCCCTGCTCAGC -3'
(R):5'- TCTGTGTGCCTGTCAGACAC -3'

Sequencing Primer
(F):5'- TGCTCAGCTCCAGGGGAAAC -3'
(R):5'- TGTCACCCCTGCTGGAATGTG -3'
Posted On2018-08-01