Incidental Mutation 'R6755:Srrt'
ID531002
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Nameserrate RNA effector molecule homolog (Arabidopsis)
Synonyms2810019G02Rik, Asr2, Ars2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6755 (G1)
Quality Score225.037
Status Not validated
Chromosome5
Chromosomal Location137295704-137307674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137302930 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 78 (K78R)
Ref Sequence ENSEMBL: ENSMUSP00000142435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040873] [ENSMUST00000196109] [ENSMUST00000197466] [ENSMUST00000197484] [ENSMUST00000198526] [ENSMUST00000199243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040873
AA Change: K78R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364
AA Change: K78R

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196109
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197376
Predicted Effect possibly damaging
Transcript: ENSMUST00000197466
AA Change: K78R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364
AA Change: K78R

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197484
SMART Domains Protein: ENSMUSP00000142660
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198526
AA Change: K78R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364
AA Change: K78R

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199243
AA Change: K78R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364
AA Change: K78R

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199473
Predicted Effect probably benign
Transcript: ENSMUST00000199605
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137295978 unclassified probably benign
IGL01062:Srrt APN 5 137296307 missense probably damaging 1.00
IGL02227:Srrt APN 5 137296274 missense probably damaging 1.00
IGL02656:Srrt APN 5 137299676 unclassified probably benign
IGL03105:Srrt APN 5 137299844 missense possibly damaging 0.72
IGL03137:Srrt APN 5 137296117 unclassified probably benign
R0281:Srrt UTSW 5 137296127 unclassified probably benign
R0322:Srrt UTSW 5 137296608 missense probably damaging 1.00
R0347:Srrt UTSW 5 137299676 unclassified probably benign
R1253:Srrt UTSW 5 137300336 missense probably benign 0.01
R1397:Srrt UTSW 5 137300261 missense possibly damaging 0.89
R1520:Srrt UTSW 5 137298766 missense probably damaging 0.99
R1561:Srrt UTSW 5 137300019 missense probably benign 0.24
R1645:Srrt UTSW 5 137302139 nonsense probably null
R1759:Srrt UTSW 5 137302950 missense probably damaging 1.00
R1770:Srrt UTSW 5 137299860 unclassified probably benign
R1795:Srrt UTSW 5 137303012 unclassified probably benign
R1848:Srrt UTSW 5 137296945 missense probably damaging 1.00
R3838:Srrt UTSW 5 137302125 critical splice donor site probably null
R5015:Srrt UTSW 5 137296009 missense probably damaging 1.00
R5068:Srrt UTSW 5 137296541 missense possibly damaging 0.93
R5163:Srrt UTSW 5 137296773 critical splice donor site probably null
R5316:Srrt UTSW 5 137296551 missense probably benign 0.16
R5343:Srrt UTSW 5 137297165 missense probably damaging 1.00
R5351:Srrt UTSW 5 137298284 makesense probably null
R5412:Srrt UTSW 5 137296287 missense probably damaging 1.00
R5806:Srrt UTSW 5 137297917 missense probably damaging 0.98
R6470:Srrt UTSW 5 137302656 missense probably damaging 1.00
R6497:Srrt UTSW 5 137297506 missense probably damaging 1.00
R6828:Srrt UTSW 5 137296968 missense probably damaging 1.00
R6875:Srrt UTSW 5 137298673 missense probably benign 0.00
R7586:Srrt UTSW 5 137302195 missense probably damaging 0.98
R7677:Srrt UTSW 5 137300148 missense probably damaging 0.99
R8027:Srrt UTSW 5 137302499 frame shift probably null
RF018:Srrt UTSW 5 137300000 missense probably benign 0.23
Z1176:Srrt UTSW 5 137298227 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACGGAGGATATGGTCTCTC -3'
(R):5'- GCTGTCAGGCTACTGTTTCC -3'

Sequencing Primer
(F):5'- GAGGATATGGTCTCTCACCCAAG -3'
(R):5'- CAGGCATTGCAGCTGATGGAC -3'
Posted On2018-08-01