Incidental Mutation 'R6755:Tm7sf3'
ID531010
Institutional Source Beutler Lab
Gene Symbol Tm7sf3
Ensembl Gene ENSMUSG00000040234
Gene Nametransmembrane 7 superfamily member 3
Synonyms2010003B14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R6755 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location146602352-146642824 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 146609973 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037709] [ENSMUST00000127529]
Predicted Effect probably null
Transcript: ENSMUST00000037709
SMART Domains Protein: ENSMUSP00000045650
Gene: ENSMUSG00000040234

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DUF4203 291 498 8.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127529
SMART Domains Protein: ENSMUSP00000118517
Gene: ENSMUSG00000040234

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Tm7sf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tm7sf3 APN 6 146606194 missense possibly damaging 0.51
IGL01930:Tm7sf3 APN 6 146610933 missense possibly damaging 0.71
IGL02073:Tm7sf3 APN 6 146623710 missense possibly damaging 0.96
IGL02720:Tm7sf3 APN 6 146613374 splice site probably benign
IGL02815:Tm7sf3 APN 6 146613473 splice site probably null
IGL03255:Tm7sf3 APN 6 146606120 unclassified probably benign
R0245:Tm7sf3 UTSW 6 146618609 missense possibly damaging 0.53
R0402:Tm7sf3 UTSW 6 146606187 missense possibly damaging 0.95
R0687:Tm7sf3 UTSW 6 146621890 missense possibly damaging 0.96
R0763:Tm7sf3 UTSW 6 146606289 missense possibly damaging 0.93
R1419:Tm7sf3 UTSW 6 146603977 missense possibly damaging 0.71
R1511:Tm7sf3 UTSW 6 146609878 missense probably benign 0.05
R4880:Tm7sf3 UTSW 6 146609860 missense possibly damaging 0.93
R5930:Tm7sf3 UTSW 6 146603911 missense possibly damaging 0.53
R6160:Tm7sf3 UTSW 6 146606289 nonsense probably null
R6229:Tm7sf3 UTSW 6 146613389 missense possibly damaging 0.71
R6912:Tm7sf3 UTSW 6 146626103 missense possibly damaging 0.91
R6920:Tm7sf3 UTSW 6 146606147 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCAGCATCTCCTACCCAGAG -3'
(R):5'- TGCTACTCCAGTATGCAGAGG -3'

Sequencing Primer
(F):5'- ATCTCCTACCCAGAGGCGTG -3'
(R):5'- TTAGGTGAACTCTACCAGCTGAGC -3'
Posted On2018-08-01