Incidental Mutation 'R6755:Plekhm1'
ID531027
Institutional Source Beutler Lab
Gene Symbol Plekhm1
Ensembl Gene ENSMUSG00000034247
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 1
SynonymsB2, D330036J23Rik, AP162
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6755 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location103364275-103412687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103387243 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 342 (S342R)
Ref Sequence ENSEMBL: ENSMUSP00000047327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041272]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041272
AA Change: S342R

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047327
Gene: ENSMUSG00000034247
AA Change: S342R

DomainStartEndE-ValueType
RUN 117 180 3.36e-20 SMART
low complexity region 246 273 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
Blast:DUF4206 448 543 2e-11 BLAST
PH 552 644 2.16e-9 SMART
low complexity region 658 674 N/A INTRINSIC
PH 702 797 2.15e-4 SMART
DUF4206 864 1068 7.51e-103 SMART
C1 1005 1058 2.72e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184350
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. Mutations in this gene are associated with autosomal recessive osteopetrosis type 6 (OPTB6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased trabecular bone mass and decreased bone resorption capacity of osteoclasts caused by defects in the peripheral positioning and secretion of lysosomes. Mice homozygous for a gene trap insertion do not exhibit any detectable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Plekhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Plekhm1 APN 11 103394783 missense possibly damaging 0.54
IGL01876:Plekhm1 APN 11 103376751 missense probably damaging 1.00
IGL02159:Plekhm1 APN 11 103380231 missense probably benign 0.04
IGL02404:Plekhm1 APN 11 103394998 missense probably benign 0.18
IGL02537:Plekhm1 APN 11 103397192 missense probably damaging 1.00
IGL02568:Plekhm1 APN 11 103395050 missense probably damaging 1.00
IGL02660:Plekhm1 APN 11 103374094 splice site probably benign
IGL03130:Plekhm1 APN 11 103377381 missense probably benign 0.17
IGL03208:Plekhm1 APN 11 103376770 missense probably benign 0.00
R0442:Plekhm1 UTSW 11 103397174 missense possibly damaging 0.45
R0491:Plekhm1 UTSW 11 103394776 missense probably benign 0.05
R0520:Plekhm1 UTSW 11 103394944 missense probably benign 0.17
R0964:Plekhm1 UTSW 11 103395082 nonsense probably null
R1189:Plekhm1 UTSW 11 103387062 missense probably benign 0.00
R1501:Plekhm1 UTSW 11 103387062 missense probably benign 0.00
R1697:Plekhm1 UTSW 11 103376884 missense probably damaging 1.00
R1781:Plekhm1 UTSW 11 103394856 missense probably damaging 1.00
R1873:Plekhm1 UTSW 11 103373998 missense probably benign 0.01
R2087:Plekhm1 UTSW 11 103397025 critical splice donor site probably null
R2215:Plekhm1 UTSW 11 103376985 missense probably damaging 1.00
R2271:Plekhm1 UTSW 11 103387122 missense probably benign 0.00
R4256:Plekhm1 UTSW 11 103370934 missense probably damaging 0.98
R4393:Plekhm1 UTSW 11 103376965 missense possibly damaging 0.51
R4526:Plekhm1 UTSW 11 103395304 missense probably damaging 0.97
R5119:Plekhm1 UTSW 11 103387315 missense possibly damaging 0.62
R5975:Plekhm1 UTSW 11 103376691 missense possibly damaging 0.49
R6389:Plekhm1 UTSW 11 103366894 missense probably benign 0.21
R6454:Plekhm1 UTSW 11 103377382 missense probably damaging 1.00
R6830:Plekhm1 UTSW 11 103376889 missense probably damaging 0.97
R7039:Plekhm1 UTSW 11 103395228 missense probably damaging 1.00
R7066:Plekhm1 UTSW 11 103370988 missense possibly damaging 0.47
R7149:Plekhm1 UTSW 11 103394916 missense probably damaging 0.98
R7349:Plekhm1 UTSW 11 103387334 missense probably damaging 0.98
R7505:Plekhm1 UTSW 11 103380029 splice site probably null
R7792:Plekhm1 UTSW 11 103397060 missense probably damaging 0.99
R7867:Plekhm1 UTSW 11 103380327 missense probably damaging 1.00
R7950:Plekhm1 UTSW 11 103380327 missense probably damaging 1.00
X0058:Plekhm1 UTSW 11 103377366 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGAAGGCTGCTGGTCTGAAG -3'
(R):5'- ATCAGTGGCTTTCTGGTCTTAC -3'

Sequencing Primer
(F):5'- CTGCTGGTCTGAAGTGCTC -3'
(R):5'- AGTCATCGTGGGCATCCTAAC -3'
Posted On2018-08-01