Incidental Mutation 'R6755:Rasa1'
ID 531032
Institutional Source Beutler Lab
Gene Symbol Rasa1
Ensembl Gene ENSMUSG00000021549
Gene Name RAS p21 protein activator 1
Synonyms p120-rasGAP, Gap
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 85214780-85289130 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85226598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 751 (F751L)
Ref Sequence ENSEMBL: ENSMUSP00000105179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109552]
AlphaFold E9PYG6
Predicted Effect possibly damaging
Transcript: ENSMUST00000109552
AA Change: F751L

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: F751L

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 37 106 N/A INTRINSIC
low complexity region 119 142 N/A INTRINSIC
SH2 170 253 9.44e-29 SMART
SH3 273 331 1.7e-10 SMART
SH2 340 423 7.44e-27 SMART
PH 466 570 5.11e-20 SMART
C2 586 680 6.9e-10 SMART
RasGAP 689 1035 2.77e-156 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152466
Predicted Effect probably benign
Transcript: ENSMUST00000163713
SMART Domains Protein: ENSMUSP00000130820
Gene: ENSMUSG00000021548

DomainStartEndE-ValueType
Pfam:Cyclin_C_2 1 65 2.4e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000223598
AA Change: F209L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Rasa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Rasa1 APN 13 85288429 missense probably benign 0.02
IGL01396:Rasa1 APN 13 85258442 missense probably benign 0.10
IGL01670:Rasa1 APN 13 85225490 missense probably damaging 0.97
IGL02095:Rasa1 APN 13 85216155 missense probably benign 0.10
IGL02822:Rasa1 APN 13 85252514 missense probably damaging 0.97
IGL03126:Rasa1 APN 13 85256396 missense possibly damaging 0.94
F5770:Rasa1 UTSW 13 85226945 splice site probably null
PIT4458001:Rasa1 UTSW 13 85227118 missense possibly damaging 0.91
R1393:Rasa1 UTSW 13 85223522 missense probably damaging 1.00
R1441:Rasa1 UTSW 13 85252421 splice site probably null
R1907:Rasa1 UTSW 13 85226572 nonsense probably null
R4243:Rasa1 UTSW 13 85244195 missense probably damaging 1.00
R4593:Rasa1 UTSW 13 85238221 splice site probably null
R4687:Rasa1 UTSW 13 85226635 missense possibly damaging 0.89
R4689:Rasa1 UTSW 13 85238163 nonsense probably null
R4753:Rasa1 UTSW 13 85288390 splice site probably null
R4758:Rasa1 UTSW 13 85234448 missense probably benign
R4774:Rasa1 UTSW 13 85250502 intron probably benign
R5363:Rasa1 UTSW 13 85288555 missense possibly damaging 0.86
R5375:Rasa1 UTSW 13 85288903 intron probably benign
R6134:Rasa1 UTSW 13 85226626 missense probably benign 0.01
R6190:Rasa1 UTSW 13 85233695 missense probably benign 0.02
R7564:Rasa1 UTSW 13 85228708 missense probably benign 0.09
R7862:Rasa1 UTSW 13 85255411 missense probably damaging 0.99
R9138:Rasa1 UTSW 13 85221516 missense possibly damaging 0.93
R9280:Rasa1 UTSW 13 85288613 missense unknown
R9328:Rasa1 UTSW 13 85255456 critical splice acceptor site probably null
R9340:Rasa1 UTSW 13 85221530 missense probably damaging 0.98
RF016:Rasa1 UTSW 13 85223488 missense possibly damaging 0.65
X0023:Rasa1 UTSW 13 85233734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCCTTGGAACTGATATAGAATG -3'
(R):5'- CACCCTATATTAATGGCAGAGAAGAAG -3'

Sequencing Primer
(F):5'- CACCACTGTTGATCACACA -3'
(R):5'- GTTGTGTACTTTCAGCAGT -3'
Posted On 2018-08-01