Incidental Mutation 'R6755:Cables1'
ID531043
Institutional Source Beutler Lab
Gene Symbol Cables1
Ensembl Gene ENSMUSG00000040957
Gene NameCDK5 and Abl enzyme substrate 1
Synonymsik3-1, interactor-1 with cdk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R6755 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location11839220-11945630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 11939825 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 479 (S479I)
Ref Sequence ENSEMBL: ENSMUSP00000129463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046948] [ENSMUST00000171109]
Predicted Effect probably null
Transcript: ENSMUST00000046948
AA Change: S453I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040639
Gene: ENSMUSG00000040957
AA Change: S453I

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 456 544 1.83e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171109
AA Change: S479I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129463
Gene: ENSMUSG00000040957
AA Change: S479I

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 482 570 1.83e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225430
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulation of the cell cycle through interactions with several cyclin-dependent kinases. One study (PMID: 16177568) reported aberrant splicing of transcripts from this gene which results in removal of the cyclin binding domain only in human cancer cells, and reduction in gene expression was shown in colorectal cancers (PMID: 17982127).Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null females exhibited reduced fertility and uterine hyperplasia. With chronic exposure to estrogen, homozygous females develop endometrial adenocarcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Cables1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Cables1 APN 18 11944564 missense probably damaging 0.99
IGL01373:Cables1 APN 18 11888764 missense probably damaging 0.98
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R2886:Cables1 UTSW 18 11939732 missense possibly damaging 0.80
R4691:Cables1 UTSW 18 11840523 nonsense probably null
R4845:Cables1 UTSW 18 11944488 missense probably damaging 0.99
R4964:Cables1 UTSW 18 11941277 missense possibly damaging 0.92
R5286:Cables1 UTSW 18 11924827 missense probably benign 0.11
R5756:Cables1 UTSW 18 11941353 missense probably damaging 1.00
R7162:Cables1 UTSW 18 11926366 critical splice donor site probably null
R7242:Cables1 UTSW 18 11840007 missense possibly damaging 0.93
R7410:Cables1 UTSW 18 11941225 missense probably benign
R7411:Cables1 UTSW 18 11840515 missense probably benign 0.01
R7965:Cables1 UTSW 18 11840212 missense probably benign 0.06
Z1177:Cables1 UTSW 18 11941317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACATATGGGCTTAGCGTG -3'
(R):5'- CATCTCCCAAGAGCTGTGTCAAC -3'

Sequencing Primer
(F):5'- ACATATGGGCTTAGCGTGTACTTTG -3'
(R):5'- CCCAAGAGCTGTGTCAACTAGGG -3'
Posted On2018-08-01