Incidental Mutation 'R6755:Nhlrc2'
ID531049
Institutional Source Beutler Lab
Gene Symbol Nhlrc2
Ensembl Gene ENSMUSG00000025078
Gene NameNHL repeat containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6755 (G1)
Quality Score157.009
Status Not validated
Chromosome19
Chromosomal Location56548261-56598846 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56591784 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 450 (V450I)
Ref Sequence ENSEMBL: ENSMUSP00000071370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071423]
Predicted Effect probably benign
Transcript: ENSMUST00000071423
AA Change: V450I

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078
AA Change: V450I

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 78 174 2.7e-14 PFAM
LY 216 258 8.44e0 SMART
Pfam:NHL 278 304 2.3e-9 PFAM
low complexity region 321 331 N/A INTRINSIC
Blast:LY 402 446 5e-8 BLAST
LY 467 509 1.91e0 SMART
Pfam:NHL 530 558 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Nhlrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Nhlrc2 APN 19 56551799 nonsense probably null
IGL01524:Nhlrc2 APN 19 56576155 missense probably benign 0.39
IGL01570:Nhlrc2 APN 19 56574787 missense possibly damaging 0.87
IGL01653:Nhlrc2 APN 19 56570850 missense probably benign 0.25
IGL02256:Nhlrc2 APN 19 56597361 missense probably benign 0.10
IGL02303:Nhlrc2 APN 19 56574848 missense probably damaging 1.00
IGL02349:Nhlrc2 APN 19 56591719 missense possibly damaging 0.94
IGL02501:Nhlrc2 APN 19 56570654 nonsense probably null
R0270:Nhlrc2 UTSW 19 56551870 missense probably damaging 1.00
R0454:Nhlrc2 UTSW 19 56570527 missense probably damaging 1.00
R2022:Nhlrc2 UTSW 19 56597278 missense probably benign 0.06
R3854:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R3855:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R3856:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R4659:Nhlrc2 UTSW 19 56576267 missense possibly damaging 0.86
R4767:Nhlrc2 UTSW 19 56570466 missense probably benign 0.03
R4992:Nhlrc2 UTSW 19 56570534 missense probably benign 0.00
R5877:Nhlrc2 UTSW 19 56570584 missense probably damaging 1.00
R6191:Nhlrc2 UTSW 19 56570859 missense probably benign 0.00
R7164:Nhlrc2 UTSW 19 56592499 missense probably damaging 1.00
R7507:Nhlrc2 UTSW 19 56597378 missense not run
R7609:Nhlrc2 UTSW 19 56594896 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAACCTGCATTCGTTTTGCTG -3'
(R):5'- CAGAGGGAGGGCTTTACTTG -3'

Sequencing Primer
(F):5'- CGTTTTGCTGGAAGTGGAAATGAAG -3'
(R):5'- TGGAACTCTCTCTGTAGACCAGG -3'
Posted On2018-08-01