Incidental Mutation 'R6756:R3hdm1'
ID 531051
Institutional Source Beutler Lab
Gene Symbol R3hdm1
Ensembl Gene ENSMUSG00000056211
Gene Name R3H domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6756 (G1)
Quality Score 217.468
Status Not validated
Chromosome 1
Chromosomal Location 128103301-128237736 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) GAA to GAAA at 128162811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036288] [ENSMUST00000187023] [ENSMUST00000187900] [ENSMUST00000188381] [ENSMUST00000189317]
AlphaFold E9Q9Q2
Predicted Effect probably null
Transcript: ENSMUST00000036288
SMART Domains Protein: ENSMUSP00000043103
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 8.8e-15 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 624 642 N/A INTRINSIC
low complexity region 909 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187023
SMART Domains Protein: ENSMUSP00000139749
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
R3H 95 172 1.9e-24 SMART
Pfam:SUZ 193 246 2.6e-11 PFAM
low complexity region 335 368 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187900
SMART Domains Protein: ENSMUSP00000141142
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 2.7e-14 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188381
SMART Domains Protein: ENSMUSP00000140538
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
R3H 107 184 3.18e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189317
SMART Domains Protein: ENSMUSP00000140175
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
R3H 137 214 1.9e-24 SMART
Pfam:SUZ 235 287 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194793
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,259,353 probably null Het
Adam7 T C 14: 68,525,279 T166A probably benign Het
Ahnak G A 19: 9,007,561 V2070M possibly damaging Het
Atp6v1a T A 16: 44,089,058 T537S probably benign Het
Atp8b3 C T 10: 80,526,061 E719K possibly damaging Het
BC022687 T C 12: 112,812,200 L192P probably damaging Het
Dpy19l1 T C 9: 24,473,784 T250A probably damaging Het
Fra10ac1 A C 19: 38,215,865 Y88D probably damaging Het
Gm13757 T C 2: 88,446,734 D68G possibly damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
H2-M9 G T 17: 36,642,335 H27N probably damaging Het
Hivep2 T C 10: 14,132,559 C1634R probably damaging Het
Meiob A T 17: 24,839,532 T470S possibly damaging Het
Ms4a7 T C 19: 11,324,525 H35R possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nf1 T A 11: 79,444,587 probably null Het
Npc1l1 T C 11: 6,215,153 Y1053C probably damaging Het
Olfr559 T C 7: 102,724,088 N134S probably benign Het
Pcdh10 T C 3: 45,380,106 V285A possibly damaging Het
Phldb2 A T 16: 45,808,320 C550S probably benign Het
Phldb3 T C 7: 24,627,331 Y595H probably damaging Het
Plekha8 C T 6: 54,624,140 Q288* probably null Het
Ppp1r36 G A 12: 76,427,922 A64T probably benign Het
Ptprd T C 4: 75,955,299 T1320A probably damaging Het
Recql4 T C 15: 76,704,859 D943G probably benign Het
Slc24a2 A G 4: 87,176,292 I330T probably benign Het
Srcin1 T C 11: 97,535,010 D433G probably damaging Het
Upb1 A G 10: 75,428,301 T194A possibly damaging Het
Other mutations in R3hdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:R3hdm1 APN 1 128236439 missense probably damaging 1.00
IGL00799:R3hdm1 APN 1 128174963 missense probably damaging 1.00
IGL00835:R3hdm1 APN 1 128235632 splice site probably benign
IGL00885:R3hdm1 APN 1 128236438 missense probably damaging 0.99
IGL00990:R3hdm1 APN 1 128162196 intron probably benign
IGL01137:R3hdm1 APN 1 128181875 missense probably damaging 1.00
IGL01323:R3hdm1 APN 1 128216543 missense probably benign
IGL01461:R3hdm1 APN 1 128178906 missense probably damaging 1.00
IGL01565:R3hdm1 APN 1 128186816 missense probably damaging 1.00
IGL01813:R3hdm1 APN 1 128175233 critical splice donor site probably null
IGL01837:R3hdm1 APN 1 128186760 nonsense probably null
IGL01934:R3hdm1 APN 1 128236535 missense probably benign 0.12
IGL02074:R3hdm1 APN 1 128169038 missense possibly damaging 0.48
IGL02532:R3hdm1 APN 1 128197099 critical splice donor site probably null
IGL02606:R3hdm1 APN 1 128190719 missense probably benign 0.00
IGL02851:R3hdm1 APN 1 128174940 splice site probably benign
driven UTSW 1 128193565 missense probably benign 0.00
R0023:R3hdm1 UTSW 1 128211192 splice site probably benign
R0280:R3hdm1 UTSW 1 128162775 missense probably benign 0.00
R0482:R3hdm1 UTSW 1 128184517 missense probably benign 0.12
R0521:R3hdm1 UTSW 1 128193703 missense probably benign 0.07
R0578:R3hdm1 UTSW 1 128231437 nonsense probably null
R0698:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0701:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0961:R3hdm1 UTSW 1 128193596 missense probably benign 0.13
R1026:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1141:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1319:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1320:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1511:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1705:R3hdm1 UTSW 1 128235084 missense probably damaging 1.00
R1991:R3hdm1 UTSW 1 128169016 missense probably damaging 0.99
R2140:R3hdm1 UTSW 1 128190693 missense probably damaging 0.99
R2437:R3hdm1 UTSW 1 128186836 missense probably damaging 0.98
R2447:R3hdm1 UTSW 1 128186929 intron probably benign
R4564:R3hdm1 UTSW 1 128221659 missense probably benign 0.16
R4640:R3hdm1 UTSW 1 128175238 splice site probably benign
R4649:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4650:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4652:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4653:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4696:R3hdm1 UTSW 1 128236766 utr 3 prime probably benign
R5393:R3hdm1 UTSW 1 128231347 missense probably benign
R5554:R3hdm1 UTSW 1 128236672 missense probably benign 0.27
R5979:R3hdm1 UTSW 1 128211223 missense probably benign 0.04
R6123:R3hdm1 UTSW 1 128169036 missense probably damaging 0.99
R6185:R3hdm1 UTSW 1 128151861 missense possibly damaging 0.93
R6618:R3hdm1 UTSW 1 128193565 missense probably benign 0.00
R6636:R3hdm1 UTSW 1 128162811 frame shift probably null
R6639:R3hdm1 UTSW 1 128162811 frame shift probably null
R7168:R3hdm1 UTSW 1 128216495 missense probably benign 0.05
R7210:R3hdm1 UTSW 1 128211208 missense possibly damaging 0.95
R7367:R3hdm1 UTSW 1 128153392 missense possibly damaging 0.64
R7536:R3hdm1 UTSW 1 128182211 splice site probably null
R7896:R3hdm1 UTSW 1 128168966 splice site probably null
R8391:R3hdm1 UTSW 1 128193478 missense
R8486:R3hdm1 UTSW 1 128178920 missense probably benign 0.11
R8490:R3hdm1 UTSW 1 128235127 missense probably benign 0.26
R8947:R3hdm1 UTSW 1 128174957 missense possibly damaging 0.60
R8990:R3hdm1 UTSW 1 128179096 missense probably damaging 1.00
R9141:R3hdm1 UTSW 1 128236475 missense probably damaging 1.00
R9195:R3hdm1 UTSW 1 128162238 missense probably benign 0.28
R9426:R3hdm1 UTSW 1 128236475 missense probably damaging 1.00
R9469:R3hdm1 UTSW 1 128179184 critical splice donor site probably null
X0017:R3hdm1 UTSW 1 128167921 missense possibly damaging 0.92
X0020:R3hdm1 UTSW 1 128169033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTATGCCCATTCTTGCTATTGC -3'
(R):5'- CACCTGGGATTTTGTTAACAAGTG -3'

Sequencing Primer
(F):5'- GGGGCTTTTGAATATGCC -3'
(R):5'- CTGGGATTTTGTTAACAAGTGTTAGC -3'
Posted On 2018-08-01