Incidental Mutation 'R6756:Pcdh10'
ID 531053
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Name protocadherin 10
Synonyms Olpc, OL-pc, 6430521D13Rik, 6430703F07Rik
MMRRC Submission 044872-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.231) question?
Stock # R6756 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 45332833-45389014 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45334541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 285 (V285A)
Ref Sequence ENSEMBL: ENSMUSP00000141529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
AlphaFold E9PXQ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000166126
AA Change: V285A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: V285A

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170695
AA Change: V285A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: V285A

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171554
AA Change: V285A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: V285A

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191843
Predicted Effect possibly damaging
Transcript: ENSMUST00000193252
AA Change: V285A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100
AA Change: V285A

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,298,512 (GRCm39) probably null Het
Adam7 T C 14: 68,762,728 (GRCm39) T166A probably benign Het
Ahnak G A 19: 8,984,925 (GRCm39) V2070M possibly damaging Het
Atp6v1a T A 16: 43,909,421 (GRCm39) T537S probably benign Het
Atp8b3 C T 10: 80,361,895 (GRCm39) E719K possibly damaging Het
Clba1 T C 12: 112,775,820 (GRCm39) L192P probably damaging Het
Dpy19l1 T C 9: 24,385,080 (GRCm39) T250A probably damaging Het
Fra10ac1 A C 19: 38,204,313 (GRCm39) Y88D probably damaging Het
Gm21738 C T 14: 19,418,824 (GRCm38) V35I possibly damaging Het
H2-M9 G T 17: 36,953,227 (GRCm39) H27N probably damaging Het
Hivep2 T C 10: 14,008,303 (GRCm39) C1634R probably damaging Het
Meiob A T 17: 25,058,506 (GRCm39) T470S possibly damaging Het
Ms4a7 T C 19: 11,301,889 (GRCm39) H35R possibly damaging Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Nf1 T A 11: 79,335,413 (GRCm39) probably null Het
Npc1l1 T C 11: 6,165,153 (GRCm39) Y1053C probably damaging Het
Or4p21 T C 2: 88,277,078 (GRCm39) D68G possibly damaging Het
Or51a25 T C 7: 102,373,295 (GRCm39) N134S probably benign Het
Phldb2 A T 16: 45,628,683 (GRCm39) C550S probably benign Het
Phldb3 T C 7: 24,326,756 (GRCm39) Y595H probably damaging Het
Plekha8 C T 6: 54,601,125 (GRCm39) Q288* probably null Het
Ppp1r36 G A 12: 76,474,696 (GRCm39) A64T probably benign Het
Ptprd T C 4: 75,873,536 (GRCm39) T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,090,548 (GRCm39) probably null Het
Recql4 T C 15: 76,589,059 (GRCm39) D943G probably benign Het
Slc24a2 A G 4: 87,094,529 (GRCm39) I330T probably benign Het
Srcin1 T C 11: 97,425,836 (GRCm39) D433G probably damaging Het
Upb1 A G 10: 75,264,135 (GRCm39) T194A possibly damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45,334,737 (GRCm39) missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45,347,210 (GRCm39) missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45,334,078 (GRCm39) missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45,333,922 (GRCm39) missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45,333,832 (GRCm39) missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45,334,733 (GRCm39) missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45,335,377 (GRCm39) missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45,334,922 (GRCm39) missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45,347,052 (GRCm39) missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45,334,448 (GRCm39) missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45,333,797 (GRCm39) missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45,333,937 (GRCm39) missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45,335,947 (GRCm39) missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45,334,934 (GRCm39) missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45,334,136 (GRCm39) missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45,333,932 (GRCm39) missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45,334,199 (GRCm39) missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45,335,005 (GRCm39) missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45,335,236 (GRCm39) missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45,336,314 (GRCm39) missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45,334,409 (GRCm39) missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45,334,409 (GRCm39) missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45,333,838 (GRCm39) missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45,334,747 (GRCm39) missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45,336,316 (GRCm39) nonsense probably null
R1687:Pcdh10 UTSW 3 45,334,450 (GRCm39) missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45,336,316 (GRCm39) nonsense probably null
R1751:Pcdh10 UTSW 3 45,338,612 (GRCm39) missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45,338,612 (GRCm39) missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45,334,372 (GRCm39) missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45,334,906 (GRCm39) missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45,333,749 (GRCm39) missense probably benign
R4083:Pcdh10 UTSW 3 45,347,142 (GRCm39) missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45,347,142 (GRCm39) missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45,336,055 (GRCm39) missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45,335,072 (GRCm39) missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45,333,917 (GRCm39) missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45,336,296 (GRCm39) missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45,347,249 (GRCm39) missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45,338,626 (GRCm39) missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45,336,247 (GRCm39) missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45,338,635 (GRCm39) missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45,335,803 (GRCm39) missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45,338,603 (GRCm39) missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45,335,075 (GRCm39) missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45,347,156 (GRCm39) missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45,335,989 (GRCm39) missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45,334,495 (GRCm39) missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45,335,734 (GRCm39) missense possibly damaging 0.87
R6968:Pcdh10 UTSW 3 45,333,977 (GRCm39) missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45,338,007 (GRCm39) missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45,335,810 (GRCm39) missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45,335,632 (GRCm39) missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45,334,657 (GRCm39) missense probably benign 0.09
R8057:Pcdh10 UTSW 3 45,333,694 (GRCm39) missense probably benign 0.00
R8082:Pcdh10 UTSW 3 45,336,179 (GRCm39) missense probably damaging 1.00
R8302:Pcdh10 UTSW 3 45,335,933 (GRCm39) missense probably damaging 0.99
R8411:Pcdh10 UTSW 3 45,333,974 (GRCm39) missense probably damaging 1.00
R8555:Pcdh10 UTSW 3 45,334,030 (GRCm39) missense probably benign 0.41
R8765:Pcdh10 UTSW 3 45,333,923 (GRCm39) missense probably damaging 1.00
R8940:Pcdh10 UTSW 3 45,338,620 (GRCm39) missense possibly damaging 0.83
R9146:Pcdh10 UTSW 3 45,334,351 (GRCm39) missense probably benign 0.08
R9306:Pcdh10 UTSW 3 45,335,804 (GRCm39) missense probably benign 0.30
R9330:Pcdh10 UTSW 3 45,335,618 (GRCm39) missense probably damaging 0.96
R9714:Pcdh10 UTSW 3 45,336,010 (GRCm39) missense probably damaging 0.98
X0013:Pcdh10 UTSW 3 45,334,001 (GRCm39) missense probably damaging 1.00
Z1177:Pcdh10 UTSW 3 45,336,164 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTCTCGCTAGACGTACAGACC -3'
(R):5'- CTCACCAGAACCTTGCAGTG -3'

Sequencing Primer
(F):5'- AGATGGCAACCGATTCGC -3'
(R):5'- TGCGCAGGCACAGCATTG -3'
Posted On 2018-08-01