Incidental Mutation 'R6756:Phldb3'
ID531058
Institutional Source Beutler Lab
Gene Symbol Phldb3
Ensembl Gene ENSMUSG00000074277
Gene Namepleckstrin homology like domain, family B, member 3
SynonymsEG232970, Gm10102
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6756 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location24610763-24629297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24627331 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 595 (Y595H)
Ref Sequence ENSEMBL: ENSMUSP00000146187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073325] [ENSMUST00000206422]
Predicted Effect probably damaging
Transcript: ENSMUST00000073325
AA Change: Y595H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073047
Gene: ENSMUSG00000074277
AA Change: Y595H

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 61 74 N/A INTRINSIC
coiled coil region 111 302 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
Blast:PH 389 447 2e-29 BLAST
Blast:PH 457 488 4e-6 BLAST
low complexity region 490 514 N/A INTRINSIC
PH 541 645 1.54e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205857
Predicted Effect probably damaging
Transcript: ENSMUST00000206422
AA Change: Y595H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,259,353 probably null Het
Adam7 T C 14: 68,525,279 T166A probably benign Het
Ahnak G A 19: 9,007,561 V2070M possibly damaging Het
Atp6v1a T A 16: 44,089,058 T537S probably benign Het
Atp8b3 C T 10: 80,526,061 E719K possibly damaging Het
BC022687 T C 12: 112,812,200 L192P probably damaging Het
Dpy19l1 T C 9: 24,473,784 T250A probably damaging Het
Fra10ac1 A C 19: 38,215,865 Y88D probably damaging Het
Gm13757 T C 2: 88,446,734 D68G possibly damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
H2-M9 G T 17: 36,642,335 H27N probably damaging Het
Hivep2 T C 10: 14,132,559 C1634R probably damaging Het
Meiob A T 17: 24,839,532 T470S possibly damaging Het
Ms4a7 T C 19: 11,324,525 H35R possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nf1 T A 11: 79,444,587 probably null Het
Npc1l1 T C 11: 6,215,153 Y1053C probably damaging Het
Olfr559 T C 7: 102,724,088 N134S probably benign Het
Pcdh10 T C 3: 45,380,106 V285A possibly damaging Het
Phldb2 A T 16: 45,808,320 C550S probably benign Het
Plekha8 C T 6: 54,624,140 Q288* probably null Het
Ppp1r36 G A 12: 76,427,922 A64T probably benign Het
Ptprd T C 4: 75,955,299 T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Recql4 T C 15: 76,704,859 D943G probably benign Het
Slc24a2 A G 4: 87,176,292 I330T probably benign Het
Srcin1 T C 11: 97,535,010 D433G probably damaging Het
Upb1 A G 10: 75,428,301 T194A possibly damaging Het
Other mutations in Phldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Phldb3 APN 7 24628870 missense probably damaging 1.00
IGL01683:Phldb3 APN 7 24619437 missense possibly damaging 0.71
IGL01732:Phldb3 APN 7 24627326 missense probably damaging 1.00
IGL01765:Phldb3 APN 7 24617375 missense possibly damaging 0.55
IGL03103:Phldb3 APN 7 24624176 missense possibly damaging 0.71
FR4548:Phldb3 UTSW 7 24628978 makesense probably null
R0052:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0230:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0234:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0655:Phldb3 UTSW 7 24624372 missense probably benign 0.07
R1731:Phldb3 UTSW 7 24619235 missense probably benign 0.10
R1935:Phldb3 UTSW 7 24617407 missense probably benign 0.01
R1936:Phldb3 UTSW 7 24617407 missense probably benign 0.01
R2155:Phldb3 UTSW 7 24612645 missense probably damaging 1.00
R2410:Phldb3 UTSW 7 24624294 missense probably benign 0.01
R4249:Phldb3 UTSW 7 24627320 missense probably damaging 1.00
R4501:Phldb3 UTSW 7 24612561 missense probably benign
R4665:Phldb3 UTSW 7 24611427 missense probably benign 0.00
R4916:Phldb3 UTSW 7 24624291 missense probably benign
R4970:Phldb3 UTSW 7 24624685 missense possibly damaging 0.73
R5017:Phldb3 UTSW 7 24620096 missense probably damaging 1.00
R5112:Phldb3 UTSW 7 24624685 missense possibly damaging 0.73
R5864:Phldb3 UTSW 7 24624146 missense possibly damaging 0.55
R5881:Phldb3 UTSW 7 24626722 critical splice donor site probably null
R6176:Phldb3 UTSW 7 24626702 missense probably damaging 1.00
R6800:Phldb3 UTSW 7 24624152 missense possibly damaging 0.93
R7223:Phldb3 UTSW 7 24624653 missense probably benign
R7485:Phldb3 UTSW 7 24611264 start gained probably benign
R7707:Phldb3 UTSW 7 24626597 missense possibly damaging 0.80
RF010:Phldb3 UTSW 7 24626495 frame shift probably null
RF031:Phldb3 UTSW 7 24626493 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTAGCATAGACATCCACTTCCCT -3'
(R):5'- CTCTGAGCTTTAGTTATGGTCCG -3'

Sequencing Primer
(F):5'- CCAGCCTTGGGGTTATCACATTG -3'
(R):5'- ATGGTCCGGTGCTGGAC -3'
Posted On2018-08-01