Incidental Mutation 'R6756:Ppp1r36'
ID531067
Institutional Source Beutler Lab
Gene Symbol Ppp1r36
Ensembl Gene ENSMUSG00000052221
Gene Nameprotein phosphatase 1, regulatory subunit 36
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R6756 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location76417538-76439492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76427922 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 64 (A64T)
Ref Sequence ENSEMBL: ENSMUSP00000152006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063977] [ENSMUST00000220187]
Predicted Effect probably benign
Transcript: ENSMUST00000063977
AA Change: A93T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069849
Gene: ENSMUSG00000052221
AA Change: A93T

DomainStartEndE-ValueType
Pfam:PPPI_inhib 52 402 5.7e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218732
Predicted Effect probably benign
Transcript: ENSMUST00000220187
AA Change: A64T

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,259,353 probably null Het
Adam7 T C 14: 68,525,279 T166A probably benign Het
Ahnak G A 19: 9,007,561 V2070M possibly damaging Het
Atp6v1a T A 16: 44,089,058 T537S probably benign Het
Atp8b3 C T 10: 80,526,061 E719K possibly damaging Het
BC022687 T C 12: 112,812,200 L192P probably damaging Het
Dpy19l1 T C 9: 24,473,784 T250A probably damaging Het
Fra10ac1 A C 19: 38,215,865 Y88D probably damaging Het
Gm13757 T C 2: 88,446,734 D68G possibly damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
H2-M9 G T 17: 36,642,335 H27N probably damaging Het
Hivep2 T C 10: 14,132,559 C1634R probably damaging Het
Meiob A T 17: 24,839,532 T470S possibly damaging Het
Ms4a7 T C 19: 11,324,525 H35R possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nf1 T A 11: 79,444,587 probably null Het
Npc1l1 T C 11: 6,215,153 Y1053C probably damaging Het
Olfr559 T C 7: 102,724,088 N134S probably benign Het
Pcdh10 T C 3: 45,380,106 V285A possibly damaging Het
Phldb2 A T 16: 45,808,320 C550S probably benign Het
Phldb3 T C 7: 24,627,331 Y595H probably damaging Het
Plekha8 C T 6: 54,624,140 Q288* probably null Het
Ptprd T C 4: 75,955,299 T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Recql4 T C 15: 76,704,859 D943G probably benign Het
Slc24a2 A G 4: 87,176,292 I330T probably benign Het
Srcin1 T C 11: 97,535,010 D433G probably damaging Het
Upb1 A G 10: 75,428,301 T194A possibly damaging Het
Other mutations in Ppp1r36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Ppp1r36 APN 12 76439117 critical splice acceptor site probably null
IGL01744:Ppp1r36 APN 12 76439232 missense possibly damaging 0.83
IGL03295:Ppp1r36 APN 12 76438418 missense probably damaging 0.97
R0099:Ppp1r36 UTSW 12 76436282 splice site probably null
R0332:Ppp1r36 UTSW 12 76427903 missense probably benign 0.32
R0463:Ppp1r36 UTSW 12 76418967 missense probably damaging 0.98
R0491:Ppp1r36 UTSW 12 76439291 missense probably benign 0.01
R1664:Ppp1r36 UTSW 12 76436254 missense possibly damaging 0.84
R2011:Ppp1r36 UTSW 12 76418926 critical splice acceptor site probably null
R3918:Ppp1r36 UTSW 12 76417657 missense probably benign 0.00
R5352:Ppp1r36 UTSW 12 76428083 missense probably damaging 1.00
R5464:Ppp1r36 UTSW 12 76428078 critical splice acceptor site probably null
R5490:Ppp1r36 UTSW 12 76437986 missense probably damaging 0.98
R5490:Ppp1r36 UTSW 12 76437987 missense possibly damaging 0.85
R5523:Ppp1r36 UTSW 12 76438118 missense possibly damaging 0.71
R5844:Ppp1r36 UTSW 12 76426792 missense possibly damaging 0.71
R5849:Ppp1r36 UTSW 12 76439157 missense probably damaging 0.99
R5866:Ppp1r36 UTSW 12 76426805 missense possibly damaging 0.71
R5996:Ppp1r36 UTSW 12 76439162 missense possibly damaging 0.71
R6443:Ppp1r36 UTSW 12 76417639 missense probably benign
R6612:Ppp1r36 UTSW 12 76437604 missense possibly damaging 0.52
R7979:Ppp1r36 UTSW 12 76428149 splice site probably null
X0025:Ppp1r36 UTSW 12 76426810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAGCCAATTCCCTGTG -3'
(R):5'- GCATTTCAGTGTCCTGGAGG -3'

Sequencing Primer
(F):5'- GGACACAGATTTGACTCCTAGAGCTC -3'
(R):5'- TCCTGGAGGGACAGCAG -3'
Posted On2018-08-01