Incidental Mutation 'R6756:BC022687'
ID531068
Institutional Source Beutler Lab
Gene Symbol BC022687
Ensembl Gene ENSMUSG00000037594
Gene NamecDNA sequence BC022687
SynonymsFlj20080, C130001I08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6756 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location112808937-112816252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112812200 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 192 (L192P)
Ref Sequence ENSEMBL: ENSMUSP00000137263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037014] [ENSMUST00000177808]
Predicted Effect probably damaging
Transcript: ENSMUST00000037014
AA Change: L192P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038002
Gene: ENSMUSG00000037594
AA Change: L192P

DomainStartEndE-ValueType
Pfam:Clathrin_bdg 189 268 3.1e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177808
AA Change: L192P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137263
Gene: ENSMUSG00000037594
AA Change: L192P

DomainStartEndE-ValueType
Pfam:Clathrin_bdg 188 268 3.8e-34 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,259,353 probably null Het
Adam7 T C 14: 68,525,279 T166A probably benign Het
Ahnak G A 19: 9,007,561 V2070M possibly damaging Het
Atp6v1a T A 16: 44,089,058 T537S probably benign Het
Atp8b3 C T 10: 80,526,061 E719K possibly damaging Het
Dpy19l1 T C 9: 24,473,784 T250A probably damaging Het
Fra10ac1 A C 19: 38,215,865 Y88D probably damaging Het
Gm13757 T C 2: 88,446,734 D68G possibly damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
H2-M9 G T 17: 36,642,335 H27N probably damaging Het
Hivep2 T C 10: 14,132,559 C1634R probably damaging Het
Meiob A T 17: 24,839,532 T470S possibly damaging Het
Ms4a7 T C 19: 11,324,525 H35R possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nf1 T A 11: 79,444,587 probably null Het
Npc1l1 T C 11: 6,215,153 Y1053C probably damaging Het
Olfr559 T C 7: 102,724,088 N134S probably benign Het
Pcdh10 T C 3: 45,380,106 V285A possibly damaging Het
Phldb2 A T 16: 45,808,320 C550S probably benign Het
Phldb3 T C 7: 24,627,331 Y595H probably damaging Het
Plekha8 C T 6: 54,624,140 Q288* probably null Het
Ppp1r36 G A 12: 76,427,922 A64T probably benign Het
Ptprd T C 4: 75,955,299 T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Recql4 T C 15: 76,704,859 D943G probably benign Het
Slc24a2 A G 4: 87,176,292 I330T probably benign Het
Srcin1 T C 11: 97,535,010 D433G probably damaging Het
Upb1 A G 10: 75,428,301 T194A possibly damaging Het
Other mutations in BC022687
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:BC022687 APN 12 112809644 missense probably damaging 0.99
IGL01813:BC022687 APN 12 112815559 missense probably damaging 1.00
IGL03090:BC022687 APN 12 112815720 unclassified probably null
IGL03225:BC022687 APN 12 112815591 missense probably damaging 0.98
R1239:BC022687 UTSW 12 112809503 missense probably benign 0.15
R6123:BC022687 UTSW 12 112810910 missense probably damaging 0.99
R6975:BC022687 UTSW 12 112809597 missense possibly damaging 0.93
R7211:BC022687 UTSW 12 112811012 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTAATGTGGGACCGGCAC -3'
(R):5'- CAGTTACTTTGCCTGGTGCG -3'

Sequencing Primer
(F):5'- GTAGGCACTTGCTTGAACCAC -3'
(R):5'- TGCGTCTCTGCAGCAAG -3'
Posted On2018-08-01