Incidental Mutation 'R6756:Gm21738'
ID 531069
Institutional Source Beutler Lab
Gene Symbol Gm21738
Ensembl Gene ENSMUSG00000095280
Gene Name predicted gene, 21738
Synonyms
MMRRC Submission 044872-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R6756 (G1)
Quality Score 91.0077
Status Not validated
Chromosome 14
Chromosomal Location (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 19418824 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 35 (V35I)
Ref Sequence ENSEMBL: ENSMUSP00000137127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177817]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000177817
AA Change: V35I

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137127
Gene: ENSMUSG00000095280
AA Change: V35I

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.11e-9 PROSPERO
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 135 1.11e-9 PROSPERO
transmembrane domain 152 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,298,512 (GRCm39) probably null Het
Adam7 T C 14: 68,762,728 (GRCm39) T166A probably benign Het
Ahnak G A 19: 8,984,925 (GRCm39) V2070M possibly damaging Het
Atp6v1a T A 16: 43,909,421 (GRCm39) T537S probably benign Het
Atp8b3 C T 10: 80,361,895 (GRCm39) E719K possibly damaging Het
Clba1 T C 12: 112,775,820 (GRCm39) L192P probably damaging Het
Dpy19l1 T C 9: 24,385,080 (GRCm39) T250A probably damaging Het
Fra10ac1 A C 19: 38,204,313 (GRCm39) Y88D probably damaging Het
H2-M9 G T 17: 36,953,227 (GRCm39) H27N probably damaging Het
Hivep2 T C 10: 14,008,303 (GRCm39) C1634R probably damaging Het
Meiob A T 17: 25,058,506 (GRCm39) T470S possibly damaging Het
Ms4a7 T C 19: 11,301,889 (GRCm39) H35R possibly damaging Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Nf1 T A 11: 79,335,413 (GRCm39) probably null Het
Npc1l1 T C 11: 6,165,153 (GRCm39) Y1053C probably damaging Het
Or4p21 T C 2: 88,277,078 (GRCm39) D68G possibly damaging Het
Or51a25 T C 7: 102,373,295 (GRCm39) N134S probably benign Het
Pcdh10 T C 3: 45,334,541 (GRCm39) V285A possibly damaging Het
Phldb2 A T 16: 45,628,683 (GRCm39) C550S probably benign Het
Phldb3 T C 7: 24,326,756 (GRCm39) Y595H probably damaging Het
Plekha8 C T 6: 54,601,125 (GRCm39) Q288* probably null Het
Ppp1r36 G A 12: 76,474,696 (GRCm39) A64T probably benign Het
Ptprd T C 4: 75,873,536 (GRCm39) T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,090,548 (GRCm39) probably null Het
Recql4 T C 15: 76,589,059 (GRCm39) D943G probably benign Het
Slc24a2 A G 4: 87,094,529 (GRCm39) I330T probably benign Het
Srcin1 T C 11: 97,425,836 (GRCm39) D433G probably damaging Het
Upb1 A G 10: 75,264,135 (GRCm39) T194A possibly damaging Het
Other mutations in Gm21738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm21738 APN 14 19,418,885 (GRCm38) missense probably benign
IGL01010:Gm21738 APN 14 19,417,361 (GRCm38) missense probably benign 0.03
IGL01018:Gm21738 APN 14 19,418,856 (GRCm38) missense probably benign 0.39
IGL01865:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01869:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01873:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01877:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01878:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01879:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01880:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01882:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01883:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01884:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01885:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01886:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01888:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01891:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01892:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01893:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01894:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01895:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01896:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01898:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01899:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01900:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01901:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01902:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01903:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01904:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01905:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01906:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01908:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01909:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01910:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01911:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01912:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01913:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01914:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01915:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01916:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01917:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01918:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01919:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01922:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01923:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01924:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01925:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01926:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01932:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01940:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01949:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
PIT4131001:Gm21738 UTSW 14 19,417,330 (GRCm38) missense probably benign 0.00
PIT4142001:Gm21738 UTSW 14 19,417,330 (GRCm38) missense probably benign 0.00
R0831:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R0831:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R0976:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1029:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R1146:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1231:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1231:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R1402:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1402:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R1638:Gm21738 UTSW 14 19,418,908 (GRCm38) missense probably benign
R1874:Gm21738 UTSW 14 19,418,824 (GRCm38) missense possibly damaging 0.64
R4392:Gm21738 UTSW 14 19,417,178 (GRCm38) missense probably benign
R4393:Gm21738 UTSW 14 19,417,178 (GRCm38) missense probably benign
R5049:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R5257:Gm21738 UTSW 14 19,415,942 (GRCm38) missense probably benign
R6915:Gm21738 UTSW 14 19,415,933 (GRCm38) missense probably benign
V5622:Gm21738 UTSW 14 19,417,180 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTGTAGGACCTGGAATATG -3'
(R):5'- CGCCAGATTCCAGGTCCTAC -3'

Sequencing Primer
(F):5'- CACTGTAGGACCTGGAATATGGAGAG -3'
(R):5'- GCCATATTCCAGGTACTACAGTGTG -3'
Posted On 2018-08-01