Incidental Mutation 'R6756:Gm21738'
ID531069
Institutional Source Beutler Lab
Gene Symbol Gm21738
Ensembl Gene ENSMUSG00000095280
Gene Namepredicted gene, 21738
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R6756 (G1)
Quality Score91.0077
Status Not validated
Chromosome14
Chromosomal Location19415857-19418930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19418824 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 35 (V35I)
Ref Sequence ENSEMBL: ENSMUSP00000137127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000177817
AA Change: V35I

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137127
Gene: ENSMUSG00000095280
AA Change: V35I

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.11e-9 PROSPERO
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 135 1.11e-9 PROSPERO
transmembrane domain 152 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,259,353 probably null Het
Adam7 T C 14: 68,525,279 T166A probably benign Het
Ahnak G A 19: 9,007,561 V2070M possibly damaging Het
Atp6v1a T A 16: 44,089,058 T537S probably benign Het
Atp8b3 C T 10: 80,526,061 E719K possibly damaging Het
BC022687 T C 12: 112,812,200 L192P probably damaging Het
Dpy19l1 T C 9: 24,473,784 T250A probably damaging Het
Fra10ac1 A C 19: 38,215,865 Y88D probably damaging Het
Gm13757 T C 2: 88,446,734 D68G possibly damaging Het
H2-M9 G T 17: 36,642,335 H27N probably damaging Het
Hivep2 T C 10: 14,132,559 C1634R probably damaging Het
Meiob A T 17: 24,839,532 T470S possibly damaging Het
Ms4a7 T C 19: 11,324,525 H35R possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nf1 T A 11: 79,444,587 probably null Het
Npc1l1 T C 11: 6,215,153 Y1053C probably damaging Het
Olfr559 T C 7: 102,724,088 N134S probably benign Het
Pcdh10 T C 3: 45,380,106 V285A possibly damaging Het
Phldb2 A T 16: 45,808,320 C550S probably benign Het
Phldb3 T C 7: 24,627,331 Y595H probably damaging Het
Plekha8 C T 6: 54,624,140 Q288* probably null Het
Ppp1r36 G A 12: 76,427,922 A64T probably benign Het
Ptprd T C 4: 75,955,299 T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Recql4 T C 15: 76,704,859 D943G probably benign Het
Slc24a2 A G 4: 87,176,292 I330T probably benign Het
Srcin1 T C 11: 97,535,010 D433G probably damaging Het
Upb1 A G 10: 75,428,301 T194A possibly damaging Het
Other mutations in Gm21738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm21738 APN 14 19418885 missense probably benign
IGL01010:Gm21738 APN 14 19417361 missense probably benign 0.03
IGL01018:Gm21738 APN 14 19418856 missense probably benign 0.39
IGL01865:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01869:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01873:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01877:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01878:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01879:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01880:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01882:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01883:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01884:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01885:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01886:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01888:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01891:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01892:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01893:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01894:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01895:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01896:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01898:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01899:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01900:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01901:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01902:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01903:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01904:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01905:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01906:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01908:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01909:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01910:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01911:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01912:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01913:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01914:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01915:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01916:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01917:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01918:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01919:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01922:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01923:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01924:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01925:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01926:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01932:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01940:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01949:Gm21738 APN 14 19416979 missense probably benign 0.01
PIT4131001:Gm21738 UTSW 14 19417330 missense probably benign 0.00
PIT4142001:Gm21738 UTSW 14 19417330 missense probably benign 0.00
R0831:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R0831:Gm21738 UTSW 14 19415963 missense probably benign
R0976:Gm21738 UTSW 14 19415963 missense probably benign
R1029:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R1146:Gm21738 UTSW 14 19415963 missense probably benign
R1231:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R1231:Gm21738 UTSW 14 19415963 missense probably benign
R1402:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R1402:Gm21738 UTSW 14 19415963 missense probably benign
R1638:Gm21738 UTSW 14 19418908 missense probably benign
R1874:Gm21738 UTSW 14 19418824 missense possibly damaging 0.64
R4392:Gm21738 UTSW 14 19417178 missense probably benign
R4393:Gm21738 UTSW 14 19417178 missense probably benign
R5049:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R5257:Gm21738 UTSW 14 19415942 missense probably benign
R6915:Gm21738 UTSW 14 19415933 missense probably benign
V5622:Gm21738 UTSW 14 19417180 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTGTAGGACCTGGAATATG -3'
(R):5'- CGCCAGATTCCAGGTCCTAC -3'

Sequencing Primer
(F):5'- CACTGTAGGACCTGGAATATGGAGAG -3'
(R):5'- GCCATATTCCAGGTACTACAGTGTG -3'
Posted On2018-08-01