Incidental Mutation 'R6756:Atp6v1a'
ID531072
Institutional Source Beutler Lab
Gene Symbol Atp6v1a
Ensembl Gene ENSMUSG00000052459
Gene NameATPase, H+ transporting, lysosomal V1 subunit A
SynonymsAtp6a1, VA68, VPP2, lysosomal 70kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6756 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location44085402-44139705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44089058 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 537 (T537S)
Ref Sequence ENSEMBL: ENSMUSP00000110314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063661] [ENSMUST00000114666]
Predicted Effect probably benign
Transcript: ENSMUST00000063661
AA Change: T537S

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066886
Gene: ENSMUSG00000052459
AA Change: T537S

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 21 83 8.5e-16 PFAM
low complexity region 206 217 N/A INTRINSIC
Pfam:ATP-synt_ab 229 455 4.4e-113 PFAM
Pfam:ATP-synt_ab_C 473 617 2.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114666
AA Change: T537S

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110314
Gene: ENSMUSG00000052459
AA Change: T537S

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 21 83 2.4e-16 PFAM
Pfam:ATP-synt_ab_Xtn 99 221 3.3e-46 PFAM
Pfam:ATP-synt_ab 230 455 3.3e-110 PFAM
Pfam:ATP-synt_ab_C 473 617 2.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain A subunit isoforms and is found in all tissues. Transcript variants derived from alternative polyadenylation exist. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,259,353 probably null Het
Adam7 T C 14: 68,525,279 T166A probably benign Het
Ahnak G A 19: 9,007,561 V2070M possibly damaging Het
Atp8b3 C T 10: 80,526,061 E719K possibly damaging Het
BC022687 T C 12: 112,812,200 L192P probably damaging Het
Dpy19l1 T C 9: 24,473,784 T250A probably damaging Het
Fra10ac1 A C 19: 38,215,865 Y88D probably damaging Het
Gm13757 T C 2: 88,446,734 D68G possibly damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
H2-M9 G T 17: 36,642,335 H27N probably damaging Het
Hivep2 T C 10: 14,132,559 C1634R probably damaging Het
Meiob A T 17: 24,839,532 T470S possibly damaging Het
Ms4a7 T C 19: 11,324,525 H35R possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nf1 T A 11: 79,444,587 probably null Het
Npc1l1 T C 11: 6,215,153 Y1053C probably damaging Het
Olfr559 T C 7: 102,724,088 N134S probably benign Het
Pcdh10 T C 3: 45,380,106 V285A possibly damaging Het
Phldb2 A T 16: 45,808,320 C550S probably benign Het
Phldb3 T C 7: 24,627,331 Y595H probably damaging Het
Plekha8 C T 6: 54,624,140 Q288* probably null Het
Ppp1r36 G A 12: 76,427,922 A64T probably benign Het
Ptprd T C 4: 75,955,299 T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Recql4 T C 15: 76,704,859 D943G probably benign Het
Slc24a2 A G 4: 87,176,292 I330T probably benign Het
Srcin1 T C 11: 97,535,010 D433G probably damaging Het
Upb1 A G 10: 75,428,301 T194A possibly damaging Het
Other mutations in Atp6v1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Atp6v1a APN 16 44111583 missense probably benign 0.00
IGL01860:Atp6v1a APN 16 44099956 missense probably damaging 1.00
IGL02691:Atp6v1a APN 16 44111619 missense probably damaging 1.00
IGL03256:Atp6v1a APN 16 44111088 unclassified probably benign
IGL03307:Atp6v1a APN 16 44111559 missense possibly damaging 0.74
R0605:Atp6v1a UTSW 16 44111496 critical splice donor site probably null
R0696:Atp6v1a UTSW 16 44087471 missense probably benign
R0883:Atp6v1a UTSW 16 44101692 splice site probably benign
R1777:Atp6v1a UTSW 16 44114705 nonsense probably null
R2370:Atp6v1a UTSW 16 44107040 missense probably benign 0.10
R2932:Atp6v1a UTSW 16 44089043 missense probably benign 0.03
R3725:Atp6v1a UTSW 16 44101757 splice site probably benign
R4224:Atp6v1a UTSW 16 44101811 missense probably damaging 1.00
R5780:Atp6v1a UTSW 16 44114643 missense probably benign 0.01
R5945:Atp6v1a UTSW 16 44099946 missense probably damaging 0.99
R6032:Atp6v1a UTSW 16 44106940 missense probably damaging 1.00
R6032:Atp6v1a UTSW 16 44106940 missense probably damaging 1.00
R6036:Atp6v1a UTSW 16 44098831 missense probably benign 0.02
R6036:Atp6v1a UTSW 16 44098831 missense probably benign 0.02
R6387:Atp6v1a UTSW 16 44087443 missense possibly damaging 0.76
R6479:Atp6v1a UTSW 16 44098758 missense probably benign 0.00
R7313:Atp6v1a UTSW 16 44114617 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCATACATCAGGTTTGGAACTC -3'
(R):5'- ACAGGCGTATTTGTATCCGTG -3'

Sequencing Primer
(F):5'- TACATCAGGTTTGGAACTCAAAAAGG -3'
(R):5'- CGTATTTGTATCCGTGTATGCC -3'
Posted On2018-08-01