Incidental Mutation 'R6756:Meiob'
ID531074
Institutional Source Beutler Lab
Gene Symbol Meiob
Ensembl Gene ENSMUSG00000024155
Gene Namemeiosis specific with OB domains
Synonyms4930528F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R6756 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24804382-24839787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24839532 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 470 (T470S)
Ref Sequence ENSEMBL: ENSMUSP00000024972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024972] [ENSMUST00000164251]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024972
AA Change: T470S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024972
Gene: ENSMUSG00000024155
AA Change: T470S

DomainStartEndE-ValueType
SCOP:d1fgua2 167 271 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164251
SMART Domains Protein: ENSMUSP00000129904
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
Lactamase_B 11 173 2.61e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male and female infertility associated with germ cell apoptosis, reduced gonads and impaired meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,259,353 probably null Het
Adam7 T C 14: 68,525,279 T166A probably benign Het
Ahnak G A 19: 9,007,561 V2070M possibly damaging Het
Atp6v1a T A 16: 44,089,058 T537S probably benign Het
Atp8b3 C T 10: 80,526,061 E719K possibly damaging Het
BC022687 T C 12: 112,812,200 L192P probably damaging Het
Dpy19l1 T C 9: 24,473,784 T250A probably damaging Het
Fra10ac1 A C 19: 38,215,865 Y88D probably damaging Het
Gm13757 T C 2: 88,446,734 D68G possibly damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
H2-M9 G T 17: 36,642,335 H27N probably damaging Het
Hivep2 T C 10: 14,132,559 C1634R probably damaging Het
Ms4a7 T C 19: 11,324,525 H35R possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nf1 T A 11: 79,444,587 probably null Het
Npc1l1 T C 11: 6,215,153 Y1053C probably damaging Het
Olfr559 T C 7: 102,724,088 N134S probably benign Het
Pcdh10 T C 3: 45,380,106 V285A possibly damaging Het
Phldb2 A T 16: 45,808,320 C550S probably benign Het
Phldb3 T C 7: 24,627,331 Y595H probably damaging Het
Plekha8 C T 6: 54,624,140 Q288* probably null Het
Ppp1r36 G A 12: 76,427,922 A64T probably benign Het
Ptprd T C 4: 75,955,299 T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Recql4 T C 15: 76,704,859 D943G probably benign Het
Slc24a2 A G 4: 87,176,292 I330T probably benign Het
Srcin1 T C 11: 97,535,010 D433G probably damaging Het
Upb1 A G 10: 75,428,301 T194A possibly damaging Het
Other mutations in Meiob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Meiob APN 17 24823629 missense probably benign 0.00
IGL01830:Meiob APN 17 24835131 missense probably benign 0.45
IGL01838:Meiob APN 17 24823669 missense possibly damaging 0.68
R0165:Meiob UTSW 17 24835161 missense probably benign 0.00
R0605:Meiob UTSW 17 24818262 splice site probably benign
R1170:Meiob UTSW 17 24836484 missense probably damaging 1.00
R1496:Meiob UTSW 17 24813052 missense possibly damaging 0.93
R1721:Meiob UTSW 17 24834047 missense probably damaging 1.00
R1857:Meiob UTSW 17 24823570 missense probably damaging 1.00
R1858:Meiob UTSW 17 24823570 missense probably damaging 1.00
R1937:Meiob UTSW 17 24818331 missense probably benign 0.34
R2066:Meiob UTSW 17 24818316 missense probably damaging 1.00
R2510:Meiob UTSW 17 24816597 splice site probably benign
R3433:Meiob UTSW 17 24816597 splice site probably benign
R3906:Meiob UTSW 17 24827948 missense probably benign 0.00
R4967:Meiob UTSW 17 24818379 missense probably damaging 1.00
R5707:Meiob UTSW 17 24835051 missense probably benign
R6109:Meiob UTSW 17 24813019 missense probably benign
R6524:Meiob UTSW 17 24832517 missense probably benign
R7167:Meiob UTSW 17 24836445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCTTTGTGGTCACTGGT -3'
(R):5'- ATTTCCCCATGTGAGAGTAGACA -3'

Sequencing Primer
(F):5'- CTTCCTTTGTGGTCACTGGTTTTCAG -3'
(R):5'- CCCATGTGAGAGTAGACAGGGTAAG -3'
Posted On2018-08-01