Incidental Mutation 'R6756:H2-M9'
ID 531075
Institutional Source Beutler Lab
Gene Symbol H2-M9
Ensembl Gene ENSMUSG00000067201
Gene Name histocompatibility 2, M region locus 9
Synonyms M9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R6756 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 36639285-36642666 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 36642335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 27 (H27N)
Ref Sequence ENSEMBL: ENSMUSP00000084411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087165] [ENSMUST00000087167]
AlphaFold O19442
Predicted Effect probably damaging
Transcript: ENSMUST00000087165
AA Change: H27N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084409
Gene: ENSMUSG00000067201
AA Change: H27N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 2.4e-45 PFAM
transmembrane domain 216 238 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087167
AA Change: H27N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084411
Gene: ENSMUSG00000067201
AA Change: H27N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 5.3e-44 PFAM
IGc1 222 293 5.73e-22 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,259,353 probably null Het
Adam7 T C 14: 68,525,279 T166A probably benign Het
Ahnak G A 19: 9,007,561 V2070M possibly damaging Het
Atp6v1a T A 16: 44,089,058 T537S probably benign Het
Atp8b3 C T 10: 80,526,061 E719K possibly damaging Het
BC022687 T C 12: 112,812,200 L192P probably damaging Het
Dpy19l1 T C 9: 24,473,784 T250A probably damaging Het
Fra10ac1 A C 19: 38,215,865 Y88D probably damaging Het
Gm13757 T C 2: 88,446,734 D68G possibly damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Hivep2 T C 10: 14,132,559 C1634R probably damaging Het
Meiob A T 17: 24,839,532 T470S possibly damaging Het
Ms4a7 T C 19: 11,324,525 H35R possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nf1 T A 11: 79,444,587 probably null Het
Npc1l1 T C 11: 6,215,153 Y1053C probably damaging Het
Olfr559 T C 7: 102,724,088 N134S probably benign Het
Pcdh10 T C 3: 45,380,106 V285A possibly damaging Het
Phldb2 A T 16: 45,808,320 C550S probably benign Het
Phldb3 T C 7: 24,627,331 Y595H probably damaging Het
Plekha8 C T 6: 54,624,140 Q288* probably null Het
Ppp1r36 G A 12: 76,427,922 A64T probably benign Het
Ptprd T C 4: 75,955,299 T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Recql4 T C 15: 76,704,859 D943G probably benign Het
Slc24a2 A G 4: 87,176,292 I330T probably benign Het
Srcin1 T C 11: 97,535,010 D433G probably damaging Het
Upb1 A G 10: 75,428,301 T194A possibly damaging Het
Other mutations in H2-M9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:H2-M9 APN 17 36641819 splice site probably null
IGL02133:H2-M9 APN 17 36641737 missense possibly damaging 0.95
IGL02323:H2-M9 APN 17 36640741 missense probably damaging 1.00
IGL02957:H2-M9 APN 17 36642157 missense probably benign 0.00
IGL03127:H2-M9 APN 17 36640822 missense possibly damaging 0.48
R0025:H2-M9 UTSW 17 36641755 missense probably damaging 1.00
R0026:H2-M9 UTSW 17 36641527 splice site probably benign
R0926:H2-M9 UTSW 17 36641773 missense probably damaging 0.98
R1171:H2-M9 UTSW 17 36641653 missense probably benign 0.14
R1264:H2-M9 UTSW 17 36642592 missense probably benign
R1995:H2-M9 UTSW 17 36641786 missense probably damaging 1.00
R4622:H2-M9 UTSW 17 36641824 splice site probably null
R4737:H2-M9 UTSW 17 36640739 nonsense probably null
R4808:H2-M9 UTSW 17 36640792 missense probably damaging 0.99
R5176:H2-M9 UTSW 17 36641631 missense probably damaging 0.98
R6785:H2-M9 UTSW 17 36642233 missense probably damaging 0.99
R7216:H2-M9 UTSW 17 36640702 missense probably benign
R7464:H2-M9 UTSW 17 36642411 splice site probably null
R8079:H2-M9 UTSW 17 36642133 missense probably benign 0.39
R8688:H2-M9 UTSW 17 36642142 missense probably damaging 1.00
R9174:H2-M9 UTSW 17 36642289 missense probably damaging 0.99
X0018:H2-M9 UTSW 17 36641722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTGCCAACTCCCAAAACTCTG -3'
(R):5'- CATCCAAATGGTGAGTGTGGG -3'

Sequencing Primer
(F):5'- GCATTTAGCTCATTCAACCATGG -3'
(R):5'- TATCCCTGGGGGTGCAGTAAC -3'
Posted On 2018-08-01