Incidental Mutation 'R6756:Ms4a7'
ID 531077
Institutional Source Beutler Lab
Gene Symbol Ms4a7
Ensembl Gene ENSMUSG00000024672
Gene Name membrane-spanning 4-domains, subfamily A, member 7
Synonyms 9130422I10Rik, CD20l4, CFFMA, A430103C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R6756 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 11321039-11336146 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11324525 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 35 (H35R)
Ref Sequence ENSEMBL: ENSMUSP00000124911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025574] [ENSMUST00000056035] [ENSMUST00000067532] [ENSMUST00000159269]
AlphaFold E9Q9V5
Predicted Effect probably benign
Transcript: ENSMUST00000025574
AA Change: H178R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025574
Gene: ENSMUSG00000024672
AA Change: H178R

DomainStartEndE-ValueType
Pfam:CD20 80 237 4.6e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056035
AA Change: H126R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054830
Gene: ENSMUSG00000024672
AA Change: H126R

DomainStartEndE-ValueType
transmembrane domain 53 72 N/A INTRINSIC
Pfam:CD20 92 185 3.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067532
AA Change: H145R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000064534
Gene: ENSMUSG00000024672
AA Change: H145R

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.9e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159269
AA Change: H35R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124911
Gene: ENSMUSG00000024672
AA Change: H35R

DomainStartEndE-ValueType
Pfam:CD20 1 100 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162785
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,259,353 probably null Het
Adam7 T C 14: 68,525,279 T166A probably benign Het
Ahnak G A 19: 9,007,561 V2070M possibly damaging Het
Atp6v1a T A 16: 44,089,058 T537S probably benign Het
Atp8b3 C T 10: 80,526,061 E719K possibly damaging Het
BC022687 T C 12: 112,812,200 L192P probably damaging Het
Dpy19l1 T C 9: 24,473,784 T250A probably damaging Het
Fra10ac1 A C 19: 38,215,865 Y88D probably damaging Het
Gm13757 T C 2: 88,446,734 D68G possibly damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
H2-M9 G T 17: 36,642,335 H27N probably damaging Het
Hivep2 T C 10: 14,132,559 C1634R probably damaging Het
Meiob A T 17: 24,839,532 T470S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nf1 T A 11: 79,444,587 probably null Het
Npc1l1 T C 11: 6,215,153 Y1053C probably damaging Het
Olfr559 T C 7: 102,724,088 N134S probably benign Het
Pcdh10 T C 3: 45,380,106 V285A possibly damaging Het
Phldb2 A T 16: 45,808,320 C550S probably benign Het
Phldb3 T C 7: 24,627,331 Y595H probably damaging Het
Plekha8 C T 6: 54,624,140 Q288* probably null Het
Ppp1r36 G A 12: 76,427,922 A64T probably benign Het
Ptprd T C 4: 75,955,299 T1320A probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Recql4 T C 15: 76,704,859 D943G probably benign Het
Slc24a2 A G 4: 87,176,292 I330T probably benign Het
Srcin1 T C 11: 97,535,010 D433G probably damaging Het
Upb1 A G 10: 75,428,301 T194A possibly damaging Het
Other mutations in Ms4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Ms4a7 APN 19 11322360 missense probably damaging 0.98
IGL01845:Ms4a7 APN 19 11322387 missense possibly damaging 0.86
IGL02409:Ms4a7 APN 19 11324443 nonsense probably null
R1851:Ms4a7 UTSW 19 11324424 missense probably benign 0.08
R5426:Ms4a7 UTSW 19 11325802 splice site probably null
R5468:Ms4a7 UTSW 19 11322414 missense probably benign 0.39
R6267:Ms4a7 UTSW 19 11333295 missense possibly damaging 0.88
R6990:Ms4a7 UTSW 19 11333241 missense probably damaging 0.99
R7260:Ms4a7 UTSW 19 11322346 missense probably damaging 1.00
R7272:Ms4a7 UTSW 19 11333278 nonsense probably null
R7397:Ms4a7 UTSW 19 11321552 missense probably benign 0.16
R7678:Ms4a7 UTSW 19 11324504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCAGCATGACCAGAGACTG -3'
(R):5'- GCCGTATAATGGTCAGAGGG -3'

Sequencing Primer
(F):5'- CATGACCAGAGACTGCTGAG -3'
(R):5'- GAACAGAAAACCCTGTACCAAACTTG -3'
Posted On 2018-08-01