Mutagenetix > Incidental Mutation

Incidental Mutation 'R6757:Gm597'

531080

Institutional Source

Beutler Lab

Gene Symbol

Gm597

Ensembl Gene

ENSMUSG00000048411

Gene Name

predicted gene 597

Synonyms

LOC210962

MMRRC Submission

044873-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R6757 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

28776117-28780252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 28780110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 30 (I30S)

Ref Sequence

ENSEMBL: ENSMUSP00000058140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059937]

AlphaFold

E9Q8J5

Predicted Effect

probably damaging
Transcript: ENSMUST00000059937
AA Change: I30S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: I30S

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	112	129	N/A	INTRINSIC
Pfam:FAM75	137	472	8.1e-14	PFAM
low complexity region	664	675	N/A	INTRINSIC
internal_repeat_1	718	807	1.4e-5	PROSPERO
internal_repeat_1	807	894	1.4e-5	PROSPERO

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	G	A	7: 34,239,077	A799V	possibly damaging	Het
A830018L16Rik	A	T	1: 11,596,334	*288Y	probably null	Het
Art2a-ps	G	T	7: 101,555,014	L106I	probably benign	Het
Bmi1	C	T	2: 18,684,029	T203M	probably damaging	Het
Cpm	A	G	10: 117,671,638	D220G	probably damaging	Het
Cyp2a22	A	C	7: 26,939,204	D52E	probably benign	Het
Dag1	A	C	9: 108,218,017	I92S	probably damaging	Het
Dntt	A	T	19: 41,037,162	H73L	probably damaging	Het
Epha5	A	C	5: 84,105,878	I716S	probably damaging	Het
Fpr-rs4	C	T	17: 18,022,132	Q134*	probably null	Het
Fzd8	T	A	18: 9,213,238	C107S	possibly damaging	Het
Gnptab	T	C	10: 88,437,502	L1047P	probably damaging	Het
Gstt1	A	T	10: 75,798,383		probably null	Het
Kdm2a	T	C	19: 4,319,243	R1115G	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myo1b	C	T	1: 51,813,048	E179K	probably damaging	Het
Nrp1	T	A	8: 128,425,868	I186N	probably damaging	Het
Olfr1512	A	G	14: 52,372,715	C113R	probably damaging	Het
Pole	T	C	5: 110,303,610	V835A	probably damaging	Het
Shprh	A	G	10: 11,181,508		probably null	Het
Slc39a14	A	T	14: 70,310,884	L238Q	probably damaging	Het
Usp40	A	T	1: 87,980,037	I619N	probably damaging	Het

Other mutations in Gm597

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Gm597	APN	1	28778651	missense	possibly damaging	0.94
IGL00885:Gm597	APN	1	28776845	missense	unknown
IGL01296:Gm597	APN	1	28777056	missense	probably benign	0.23
IGL01476:Gm597	APN	1	28777453	missense	probably benign	0.04
IGL02125:Gm597	APN	1	28776338	missense	possibly damaging	0.91
IGL02410:Gm597	APN	1	28778631	missense	probably benign	0.25
IGL02982:Gm597	APN	1	28778054	missense	probably damaging	1.00
IGL03031:Gm597	APN	1	28778583	missense	probably benign	0.03
IGL03267:Gm597	APN	1	28777121	missense	probably damaging	1.00
R0294:Gm597	UTSW	1	28778663	missense	probably benign	0.00
R0433:Gm597	UTSW	1	28777342	nonsense	probably null
R0485:Gm597	UTSW	1	28778142	missense	probably damaging	1.00
R0645:Gm597	UTSW	1	28776930	missense	probably damaging	0.99
R0744:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R0836:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R1036:Gm597	UTSW	1	28777802	missense	probably benign	0.01
R1302:Gm597	UTSW	1	28776340	missense	probably benign	0.00
R1394:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1395:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1514:Gm597	UTSW	1	28778748	missense	possibly damaging	0.83
R1535:Gm597	UTSW	1	28777424	missense	probably damaging	1.00
R2004:Gm597	UTSW	1	28777179	missense	probably damaging	1.00
R2021:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R2022:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R3115:Gm597	UTSW	1	28776329	missense	possibly damaging	0.92
R3615:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3616:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3862:Gm597	UTSW	1	28777641	missense	probably damaging	0.98
R4067:Gm597	UTSW	1	28777631	missense	probably damaging	0.98
R4119:Gm597	UTSW	1	28777973	missense	probably damaging	0.99
R4415:Gm597	UTSW	1	28777133	missense	probably benign	0.01
R5010:Gm597	UTSW	1	28777862	missense	possibly damaging	0.52
R5109:Gm597	UTSW	1	28777555	missense	possibly damaging	0.46
R5122:Gm597	UTSW	1	28780060	missense	probably benign	0.00
R5533:Gm597	UTSW	1	28778082	missense	probably damaging	1.00
R6085:Gm597	UTSW	1	28778227	missense	possibly damaging	0.55
R6116:Gm597	UTSW	1	28778699	missense	probably benign	0.01
R6750:Gm597	UTSW	1	28777414	missense	probably damaging	0.98
R6774:Gm597	UTSW	1	28776893	missense	probably benign	0.00
R7156:Gm597	UTSW	1	28776767	missense	possibly damaging	0.53
R7365:Gm597	UTSW	1	28780152	missense	probably benign	0.04
R7739:Gm597	UTSW	1	28777608	missense	possibly damaging	0.72
R7996:Gm597	UTSW	1	28778406	missense	probably damaging	0.98
R8082:Gm597	UTSW	1	28777498	missense	probably benign	0.08
R8281:Gm597	UTSW	1	28778144	missense	possibly damaging	0.77
R8514:Gm597	UTSW	1	28778505	missense	probably damaging	1.00
R8944:Gm597	UTSW	1	28777074	missense	probably benign	0.00
R9042:Gm597	UTSW	1	28776956	missense	possibly damaging	0.72
R9101:Gm597	UTSW	1	28776659	missense	probably benign	0.04
R9106:Gm597	UTSW	1	28776894	missense	probably benign	0.00
R9173:Gm597	UTSW	1	28777349	missense	probably benign	0.22
R9596:Gm597	UTSW	1	28776607	missense	probably benign	0.07
R9632:Gm597	UTSW	1	28778039	missense	probably benign	0.20
R9656:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9659:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9661:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9663:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9710:Gm597	UTSW	1	28778039	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- CTTCTAGAGATTTCTGTTCATGTGTC -3'
(R):5'- CCTGAGGCCTCCTGAAAGGT -3'

Sequencing Primer
(F):5'- AACATGCCCCTGAGAGAGCTTG -3'
(R):5'- GTCAGATCTGTACTCCAGGACTCAG -3'

Posted On

2018-08-01