Incidental Mutation 'R6757:Usp40'
ID531082
Institutional Source Beutler Lab
Gene Symbol Usp40
Ensembl Gene ENSMUSG00000005501
Gene Nameubiquitin specific peptidase 40
SynonymsB230215L03Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001033291

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6757 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location87945119-88008551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87980037 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 619 (I619N)
Ref Sequence ENSEMBL: ENSMUSP00000140107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040783] [ENSMUST00000187758] [ENSMUST00000188332]
Predicted Effect probably damaging
Transcript: ENSMUST00000040783
AA Change: I619N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038533
Gene: ENSMUSG00000005501
AA Change: I619N

DomainStartEndE-ValueType
Pfam:UCH 40 344 1.1e-31 PFAM
Pfam:UCH_1 41 320 1.2e-20 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187758
AA Change: I619N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140107
Gene: ENSMUSG00000005501
AA Change: I619N

DomainStartEndE-ValueType
Pfam:UCH 40 346 8.7e-41 PFAM
Pfam:UCH_1 41 319 2.4e-22 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188332
SMART Domains Protein: ENSMUSP00000140574
Gene: ENSMUSG00000005501

DomainStartEndE-ValueType
Pfam:UCH 40 70 5.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189409
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,239,077 A799V possibly damaging Het
A830018L16Rik A T 1: 11,596,334 *288Y probably null Het
Art2a-ps G T 7: 101,555,014 L106I probably benign Het
Bmi1 C T 2: 18,684,029 T203M probably damaging Het
Cpm A G 10: 117,671,638 D220G probably damaging Het
Cyp2a22 A C 7: 26,939,204 D52E probably benign Het
Dag1 A C 9: 108,218,017 I92S probably damaging Het
Dntt A T 19: 41,037,162 H73L probably damaging Het
Epha5 A C 5: 84,105,878 I716S probably damaging Het
Fpr-rs4 C T 17: 18,022,132 Q134* probably null Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm597 A C 1: 28,780,110 I30S probably damaging Het
Gnptab T C 10: 88,437,502 L1047P probably damaging Het
Gstt1 A T 10: 75,798,383 probably null Het
Kdm2a T C 19: 4,319,243 R1115G probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo1b C T 1: 51,813,048 E179K probably damaging Het
Nrp1 T A 8: 128,425,868 I186N probably damaging Het
Olfr1512 A G 14: 52,372,715 C113R probably damaging Het
Pole T C 5: 110,303,610 V835A probably damaging Het
Shprh A G 10: 11,181,508 probably null Het
Slc39a14 A T 14: 70,310,884 L238Q probably damaging Het
Other mutations in Usp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Usp40 APN 1 88004238 splice site probably benign
IGL00828:Usp40 APN 1 87978306 unclassified probably benign
IGL01090:Usp40 APN 1 87962465 missense probably benign 0.01
IGL01123:Usp40 APN 1 87986123 missense probably benign 0.01
IGL01401:Usp40 APN 1 87994198 missense probably damaging 1.00
IGL02506:Usp40 APN 1 87982016 missense probably damaging 0.98
IGL02580:Usp40 APN 1 87980966 splice site probably null
IGL02625:Usp40 APN 1 87950017 missense probably benign 0.19
IGL02811:Usp40 APN 1 87995736 missense probably damaging 1.00
IGL02958:Usp40 APN 1 87978485 missense probably damaging 0.99
G5030:Usp40 UTSW 1 87994219 missense probably damaging 1.00
R0019:Usp40 UTSW 1 87978411 missense probably benign 0.00
R0282:Usp40 UTSW 1 87980958 splice site probably benign
R0453:Usp40 UTSW 1 87946598 makesense probably null
R0646:Usp40 UTSW 1 87978522 missense probably benign 0.00
R1440:Usp40 UTSW 1 87982086 missense probably benign 0.01
R1490:Usp40 UTSW 1 87988965 nonsense probably null
R1620:Usp40 UTSW 1 87994225 missense probably damaging 1.00
R1881:Usp40 UTSW 1 87994271 missense probably benign 0.08
R1903:Usp40 UTSW 1 87982056 missense probably benign 0.15
R1912:Usp40 UTSW 1 87946646 missense probably benign 0.00
R1919:Usp40 UTSW 1 87995842 missense possibly damaging 0.75
R1976:Usp40 UTSW 1 87978536 missense probably benign 0.00
R2111:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2112:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2163:Usp40 UTSW 1 87995858 splice site probably benign
R2432:Usp40 UTSW 1 87982082 missense probably benign
R2865:Usp40 UTSW 1 87949979 nonsense probably null
R3885:Usp40 UTSW 1 87967269 missense probably damaging 1.00
R4360:Usp40 UTSW 1 87952361 missense probably damaging 1.00
R4370:Usp40 UTSW 1 87997875 missense probably benign
R4496:Usp40 UTSW 1 87995737 missense possibly damaging 0.69
R4714:Usp40 UTSW 1 87967179 splice site probably null
R4888:Usp40 UTSW 1 87986201 critical splice acceptor site probably null
R4944:Usp40 UTSW 1 87952355 missense probably benign 0.10
R5269:Usp40 UTSW 1 87995782 missense probably benign 0.01
R5629:Usp40 UTSW 1 87981009 missense probably benign
R5696:Usp40 UTSW 1 87995752 missense probably benign 0.27
R5756:Usp40 UTSW 1 87951691 missense possibly damaging 0.66
R5887:Usp40 UTSW 1 87999870 missense probably damaging 1.00
R5910:Usp40 UTSW 1 87968400 nonsense probably null
R6014:Usp40 UTSW 1 87980016 missense probably damaging 1.00
R6044:Usp40 UTSW 1 87990150 missense probably benign
R6083:Usp40 UTSW 1 87978559 missense probably benign 0.01
R6299:Usp40 UTSW 1 87997927 missense probably damaging 0.99
R6625:Usp40 UTSW 1 87967213 missense probably benign 0.01
R6810:Usp40 UTSW 1 87981033 missense probably benign 0.11
R7110:Usp40 UTSW 1 87986162 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTCTGATGGCTAACTGAATGCC -3'
(R):5'- CTCACAAAACTGTATAATGGTCCAG -3'

Sequencing Primer
(F):5'- CTTCCCGAGTACTGAGATTGTAAG -3'
(R):5'- CATTGAAGAGTCATGGCTCT -3'
Posted On2018-08-01