Incidental Mutation 'R6757:Fzd8'
ID531099
Institutional Source Beutler Lab
Gene Symbol Fzd8
Ensembl Gene ENSMUSG00000036904
Gene Namefrizzled class receptor 8
SynonymsmFZ8, Fz8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6757 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location9212856-9216201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9213238 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 107 (C107S)
Ref Sequence ENSEMBL: ENSMUSP00000039660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041080]
PDB Structure
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041080
AA Change: C107S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: C107S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 34 153 9.06e-73 SMART
low complexity region 161 228 N/A INTRINSIC
Frizzled 264 621 1.47e-219 SMART
low complexity region 624 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,239,077 A799V possibly damaging Het
A830018L16Rik A T 1: 11,596,334 *288Y probably null Het
Art2a-ps G T 7: 101,555,014 L106I probably benign Het
Bmi1 C T 2: 18,684,029 T203M probably damaging Het
Cpm A G 10: 117,671,638 D220G probably damaging Het
Cyp2a22 A C 7: 26,939,204 D52E probably benign Het
Dag1 A C 9: 108,218,017 I92S probably damaging Het
Dntt A T 19: 41,037,162 H73L probably damaging Het
Epha5 A C 5: 84,105,878 I716S probably damaging Het
Fpr-rs4 C T 17: 18,022,132 Q134* probably null Het
Gm597 A C 1: 28,780,110 I30S probably damaging Het
Gnptab T C 10: 88,437,502 L1047P probably damaging Het
Gstt1 A T 10: 75,798,383 probably null Het
Kdm2a T C 19: 4,319,243 R1115G probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo1b C T 1: 51,813,048 E179K probably damaging Het
Nrp1 T A 8: 128,425,868 I186N probably damaging Het
Olfr1512 A G 14: 52,372,715 C113R probably damaging Het
Pole T C 5: 110,303,610 V835A probably damaging Het
Shprh A G 10: 11,181,508 probably null Het
Slc39a14 A T 14: 70,310,884 L238Q probably damaging Het
Usp40 A T 1: 87,980,037 I619N probably damaging Het
Other mutations in Fzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fzd8 APN 18 9213068 missense unknown
IGL01511:Fzd8 APN 18 9213293 missense unknown
IGL03129:Fzd8 APN 18 9214270 missense probably damaging 1.00
Stilt UTSW 18 9213880 missense probably damaging 1.00
R0058:Fzd8 UTSW 18 9213985 missense possibly damaging 0.92
R0715:Fzd8 UTSW 18 9212947 missense unknown
R0966:Fzd8 UTSW 18 9214745 missense probably damaging 0.99
R1717:Fzd8 UTSW 18 9214364 missense probably damaging 1.00
R1751:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1761:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1905:Fzd8 UTSW 18 9213803 missense probably damaging 1.00
R1956:Fzd8 UTSW 18 9214502 missense probably damaging 1.00
R2892:Fzd8 UTSW 18 9214514 missense probably damaging 1.00
R3897:Fzd8 UTSW 18 9214939 missense possibly damaging 0.89
R3968:Fzd8 UTSW 18 9214070 missense probably damaging 0.98
R4934:Fzd8 UTSW 18 9214492 frame shift probably null
R5366:Fzd8 UTSW 18 9213880 missense probably damaging 1.00
R5624:Fzd8 UTSW 18 9213268 missense unknown
R6261:Fzd8 UTSW 18 9214598 missense possibly damaging 0.61
R6758:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6899:Fzd8 UTSW 18 9214729 missense probably damaging 0.98
R7242:Fzd8 UTSW 18 9214171 missense probably damaging 1.00
R8140:Fzd8 UTSW 18 9213797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTACAACTACACTTACATGCC -3'
(R):5'- TCTTGACGCGGTTGTAGAGC -3'

Sequencing Primer
(F):5'- ACTTACATGCCCAACCAGTTC -3'
(R):5'- TGGACACGCTCACCATGG -3'
Posted On2018-08-01