Incidental Mutation 'R6758:Rorc'
ID 531104
Institutional Source Beutler Lab
Gene Symbol Rorc
Ensembl Gene ENSMUSG00000028150
Gene Name RAR-related orphan receptor gamma
Synonyms Thor, RORgamma, thymus orphan receptor
MMRRC Submission 044874-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.865) question?
Stock # R6758 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 94280101-94305583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94294825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 51 (N51S)
Ref Sequence ENSEMBL: ENSMUSP00000143763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029795] [ENSMUST00000197040] [ENSMUST00000200009]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000029795
AA Change: N72S

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150
AA Change: N72S

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197040
AA Change: N51S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150
AA Change: N51S

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198793
Predicted Effect possibly damaging
Transcript: ENSMUST00000200009
AA Change: N57S

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150
AA Change: N57S

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of peripheral and mesenteric lymph nodes and Peyer's patches, reduced numbers of thymocytes, and increased apoptosis with loss of thymic expression of anti-apoptosic factor Bcl-xL. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A T 5: 90,411,172 (GRCm39) D1374E probably damaging Het
Cd96 C A 16: 45,938,367 (GRCm39) V33L possibly damaging Het
Drd1 T C 13: 54,207,308 (GRCm39) E295G probably benign Het
Fzd8 T A 18: 9,213,238 (GRCm39) C107S possibly damaging Het
Gm10801 C CGTG 2: 98,494,152 (GRCm39) probably null Het
Gm11595 C A 11: 99,663,366 (GRCm39) V105L unknown Het
Gm11595 A T 11: 99,663,367 (GRCm39) C104* probably null Het
Igsf3 T C 3: 101,332,814 (GRCm39) Y31H probably damaging Het
Ikzf2 A T 1: 69,578,059 (GRCm39) H483Q probably damaging Het
Itgbl1 A G 14: 124,094,901 (GRCm39) K309E probably benign Het
Myt1l T G 12: 29,892,599 (GRCm39) Y79D possibly damaging Het
Nid2 T A 14: 19,852,551 (GRCm39) S1086R probably damaging Het
Or1o1 A G 17: 37,716,586 (GRCm39) D49G probably damaging Het
Or5h24 T C 16: 58,919,328 (GRCm39) E9G probably damaging Het
Or6c65 T C 10: 129,603,920 (GRCm39) I185T probably damaging Het
Sanbr T C 11: 23,538,475 (GRCm39) probably null Het
Simc1 C T 13: 54,673,361 (GRCm39) P570S possibly damaging Het
Smn1 T A 13: 100,268,946 (GRCm39) M264K possibly damaging Het
Tiam2 A G 17: 3,568,678 (GRCm39) D1608G probably benign Het
Tll1 C A 8: 64,494,439 (GRCm39) probably null Het
Trim15 A G 17: 37,173,233 (GRCm39) L284P probably benign Het
Other mutations in Rorc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Rorc APN 3 94,296,094 (GRCm39) missense probably damaging 1.00
beto UTSW 3 94,284,915 (GRCm39) splice site probably null
brazil UTSW 3 94,296,826 (GRCm39) missense probably damaging 1.00
cashew UTSW 3 94,298,460 (GRCm39) missense probably damaging 1.00
chestnut UTSW 3 94,284,916 (GRCm39) splice site probably benign
macadamias UTSW 3 94,304,609 (GRCm39) nonsense probably null
macadamias2 UTSW 3 94,294,500 (GRCm39) missense probably damaging 1.00
R0014:Rorc UTSW 3 94,284,920 (GRCm39) splice site probably benign
R0115:Rorc UTSW 3 94,284,916 (GRCm39) splice site probably benign
R0365:Rorc UTSW 3 94,296,069 (GRCm39) missense probably damaging 1.00
R1470:Rorc UTSW 3 94,304,609 (GRCm39) nonsense probably null
R1470:Rorc UTSW 3 94,304,609 (GRCm39) nonsense probably null
R1914:Rorc UTSW 3 94,298,480 (GRCm39) missense probably damaging 1.00
R1915:Rorc UTSW 3 94,298,480 (GRCm39) missense probably damaging 1.00
R2142:Rorc UTSW 3 94,296,833 (GRCm39) missense probably benign 0.04
R2510:Rorc UTSW 3 94,296,427 (GRCm39) missense probably benign 0.30
R4135:Rorc UTSW 3 94,296,826 (GRCm39) missense probably damaging 1.00
R4181:Rorc UTSW 3 94,294,500 (GRCm39) missense probably damaging 1.00
R4574:Rorc UTSW 3 94,296,291 (GRCm39) missense probably benign 0.00
R4701:Rorc UTSW 3 94,299,017 (GRCm39) missense probably null 1.00
R5014:Rorc UTSW 3 94,298,460 (GRCm39) missense probably damaging 1.00
R5233:Rorc UTSW 3 94,304,632 (GRCm39) missense probably benign 0.26
R7069:Rorc UTSW 3 94,280,214 (GRCm39) nonsense probably null
R7162:Rorc UTSW 3 94,284,915 (GRCm39) splice site probably null
R7169:Rorc UTSW 3 94,296,487 (GRCm39) missense probably benign 0.00
R7730:Rorc UTSW 3 94,300,421 (GRCm39) missense probably benign 0.43
R7922:Rorc UTSW 3 94,298,495 (GRCm39) missense probably damaging 0.98
R8365:Rorc UTSW 3 94,282,366 (GRCm39) missense probably benign 0.01
R9354:Rorc UTSW 3 94,280,170 (GRCm39) unclassified probably benign
X0063:Rorc UTSW 3 94,299,058 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGATCACAGGGTCCATCAC -3'
(R):5'- TTTTCTGGAGCAGAGCCTGG -3'

Sequencing Primer
(F):5'- CAGGGTCCATCACAATTATACAGTGG -3'
(R):5'- TGAAGAGCCTTGAGGACCCTC -3'
Posted On 2018-08-01