Incidental Mutation 'R6758:Olfr808'
List |< first << previous [record 16 of 22] next >> last >|
ID531108
Institutional Source Beutler Lab
Gene Symbol Olfr808
Ensembl Gene ENSMUSG00000049894
Gene Nameolfactory receptor 808
SynonymsGA_x6K02T2PULF-11446184-11447122, MOR112-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6758 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129765482-129771713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129768051 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 185 (I185T)
Ref Sequence ENSEMBL: ENSMUSP00000145315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060636] [ENSMUST00000203236]
Predicted Effect probably damaging
Transcript: ENSMUST00000060636
AA Change: I185T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059714
Gene: ENSMUSG00000049894
AA Change: I185T

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.8e-53 PFAM
Pfam:7tm_1 39 288 7.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203236
AA Change: I185T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145315
Gene: ENSMUSG00000049894
AA Change: I185T

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.8e-53 PFAM
Pfam:7tm_1 39 288 7.7e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,588,475 probably null Het
Ankrd17 A T 5: 90,263,313 D1374E probably damaging Het
Cd96 C A 16: 46,118,004 V33L possibly damaging Het
Drd1 T C 13: 54,053,289 E295G probably benign Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm11595 C A 11: 99,772,540 V105L unknown Het
Gm11595 A T 11: 99,772,541 C104* probably null Het
Igsf3 T C 3: 101,425,498 Y31H probably damaging Het
Ikzf2 A T 1: 69,538,900 H483Q probably damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Myt1l T G 12: 29,842,600 Y79D possibly damaging Het
Nid2 T A 14: 19,802,483 S1086R probably damaging Het
Olfr107 A G 17: 37,405,695 D49G probably damaging Het
Olfr192 T C 16: 59,098,965 E9G probably damaging Het
Rorc A G 3: 94,387,518 N51S possibly damaging Het
Simc1 C T 13: 54,525,548 P570S possibly damaging Het
Smn1 T A 13: 100,132,438 M264K possibly damaging Het
Tiam2 A G 17: 3,518,403 D1608G probably benign Het
Tll1 C A 8: 64,041,405 probably null Het
Trim15 A G 17: 36,862,341 L284P probably benign Het
Other mutations in Olfr808
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr808 APN 10 129767586 missense probably null 0.99
IGL01313:Olfr808 APN 10 129767595 missense probably damaging 1.00
IGL01923:Olfr808 APN 10 129768104 missense probably benign 0.01
IGL02010:Olfr808 APN 10 129768267 missense probably benign 0.07
IGL02393:Olfr808 APN 10 129767793 missense probably benign 0.06
IGL03026:Olfr808 APN 10 129768041 missense probably benign 0.00
R1181:Olfr808 UTSW 10 129768164 missense probably benign 0.09
R1760:Olfr808 UTSW 10 129767548 missense probably benign 0.06
R1844:Olfr808 UTSW 10 129767856 missense probably benign 0.03
R2697:Olfr808 UTSW 10 129767924 missense probably benign 0.09
R3025:Olfr808 UTSW 10 129767673 missense probably damaging 1.00
R3414:Olfr808 UTSW 10 129768432 missense probably benign
R5824:Olfr808 UTSW 10 129768381 missense probably damaging 1.00
R6260:Olfr808 UTSW 10 129767520 missense probably benign 0.00
R6723:Olfr808 UTSW 10 129768415 missense probably benign 0.38
R7305:Olfr808 UTSW 10 129767851 nonsense probably null
R7422:Olfr808 UTSW 10 129768267 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTAAACCTCTGCACTATACAGC -3'
(R):5'- TAGCACCACACCTTCTCTGG -3'

Sequencing Primer
(F):5'- CAGCTATCATTAACAACAAAGTGTGC -3'
(R):5'- ACCACACCTTCTCTGGCAGATG -3'
Posted On2018-08-01