Incidental Mutation 'R6758:0610010F05Rik'
ID 531109
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene Name RIKEN cDNA 0610010F05 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R6758 (G1)
Quality Score 97.0078
Status Not validated
Chromosome 11
Chromosomal Location 23564961-23633639 bp(-) (GRCm38)
Type of Mutation splice site (160 bp from exon)
DNA Base Change (assembly) T to C at 23588475 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000093267] [ENSMUST00000109532] [ENSMUST00000123909] [ENSMUST00000155903] [ENSMUST00000180260]
AlphaFold Q68FF0
Predicted Effect probably null
Transcript: ENSMUST00000043356
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093267
SMART Domains Protein: ENSMUSP00000090955
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
Pfam:DUF3342 1 303 7.7e-107 PFAM
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109532
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123909
SMART Domains Protein: ENSMUSP00000117103
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155903
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180260
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A T 5: 90,263,313 D1374E probably damaging Het
Cd96 C A 16: 46,118,004 V33L possibly damaging Het
Drd1 T C 13: 54,053,289 E295G probably benign Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm11595 C A 11: 99,772,540 V105L unknown Het
Gm11595 A T 11: 99,772,541 C104* probably null Het
Igsf3 T C 3: 101,425,498 Y31H probably damaging Het
Ikzf2 A T 1: 69,538,900 H483Q probably damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Myt1l T G 12: 29,842,600 Y79D possibly damaging Het
Nid2 T A 14: 19,802,483 S1086R probably damaging Het
Olfr107 A G 17: 37,405,695 D49G probably damaging Het
Olfr192 T C 16: 59,098,965 E9G probably damaging Het
Olfr808 T C 10: 129,768,051 I185T probably damaging Het
Rorc A G 3: 94,387,518 N51S possibly damaging Het
Simc1 C T 13: 54,525,548 P570S possibly damaging Het
Smn1 T A 13: 100,132,438 M264K possibly damaging Het
Tiam2 A G 17: 3,518,403 D1608G probably benign Het
Tll1 C A 8: 64,041,405 probably null Het
Trim15 A G 17: 36,862,341 L284P probably benign Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice site probably benign
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null
IGL01819:0610010F05Rik APN 11 23584561 missense probably benign 0.29
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 0.99
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense probably benign 0.45
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 0.99
R1568:0610010F05Rik UTSW 11 23589971 missense probably damaging 1.00
R2163:0610010F05Rik UTSW 11 23576826 splice site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 splice site probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
R6860:0610010F05Rik UTSW 11 23625100 missense probably damaging 1.00
R6910:0610010F05Rik UTSW 11 23620447 missense probably damaging 0.99
R7255:0610010F05Rik UTSW 11 23620465 missense probably benign 0.41
R7286:0610010F05Rik UTSW 11 23622479 missense probably benign 0.07
R7603:0610010F05Rik UTSW 11 23566191 missense probably benign
R7618:0610010F05Rik UTSW 11 23584550 missense possibly damaging 0.91
R7717:0610010F05Rik UTSW 11 23606757 missense probably benign 0.05
R8110:0610010F05Rik UTSW 11 23576764 missense probably benign
R8677:0610010F05Rik UTSW 11 23595471 missense probably benign 0.24
R9165:0610010F05Rik UTSW 11 23615244 missense probably benign 0.00
R9175:0610010F05Rik UTSW 11 23584518 critical splice donor site probably null
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice site probably null
Z1177:0610010F05Rik UTSW 11 23624960 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGTACACACAGAGCACCAGG -3'
(R):5'- TTCTCAGAAGAGGAAGAGTATACCACG -3'

Sequencing Primer
(F):5'- CACACAGAGCACCAGGGTTTATTTTC -3'
(R):5'- TCTGAGGTCACTGAAGATGAAGTC -3'
Posted On 2018-08-01