Incidental Mutation 'R6758:Drd1'
List |< first << previous [record 4 of 22] next >> last >|
ID531113
Institutional Source Beutler Lab
Gene Symbol Drd1
Ensembl Gene ENSMUSG00000021478
Gene Namedopamine receptor D1
SynonymsDrd1a, D1 receptor, C030036C15Rik, Gpcr15, Drd-1
MMRRC Submission
Accession Numbers

Genbank: NM_010076.3; Ensembl: ENSMUST00000021932

Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R6758 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location54051183-54055705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54053289 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 295 (E295G)
Ref Sequence ENSEMBL: ENSMUSP00000152768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021932] [ENSMUST00000221470]
Predicted Effect probably benign
Transcript: ENSMUST00000021932
AA Change: E302G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021932
Gene: ENSMUSG00000021478
AA Change: E302G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 244 7.9e-10 PFAM
Pfam:7TM_GPCR_Srsx 33 345 7e-11 PFAM
Pfam:7tm_1 39 331 6.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221470
AA Change: E295G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222706
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D1 subtype of the dopamine receptor. The D1 subtype is the most abundant dopamine receptor in the central nervous system. This G-protein coupled receptor stimulates adenylyl cyclase and activates cyclic AMP-dependent protein kinases. D1 receptors regulate neuronal growth and development, mediate some behavioral responses, and modulate dopamine receptor D2-mediated events. Alternate transcription initiation sites result in two transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show variably abnormalities that may include growth retardation, death after weaning unless given hydrated food, nonresponsiveness to dopamine D1 receptor agonists and antagonists, and normal to hyperactive locomotor activity. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,588,475 probably null Het
Ankrd17 A T 5: 90,263,313 D1374E probably damaging Het
Cd96 C A 16: 46,118,004 V33L possibly damaging Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm11595 C A 11: 99,772,540 V105L unknown Het
Gm11595 A T 11: 99,772,541 C104* probably null Het
Igsf3 T C 3: 101,425,498 Y31H probably damaging Het
Ikzf2 A T 1: 69,538,900 H483Q probably damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Myt1l T G 12: 29,842,600 Y79D possibly damaging Het
Nid2 T A 14: 19,802,483 S1086R probably damaging Het
Olfr107 A G 17: 37,405,695 D49G probably damaging Het
Olfr192 T C 16: 59,098,965 E9G probably damaging Het
Olfr808 T C 10: 129,768,051 I185T probably damaging Het
Rorc A G 3: 94,387,518 N51S possibly damaging Het
Simc1 C T 13: 54,525,548 P570S possibly damaging Het
Smn1 T A 13: 100,132,438 M264K possibly damaging Het
Tiam2 A G 17: 3,518,403 D1608G probably benign Het
Tll1 C A 8: 64,041,405 probably null Het
Trim15 A G 17: 36,862,341 L284P probably benign Het
Other mutations in Drd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Drd1 APN 13 54053878 missense probably damaging 1.00
IGL00231:Drd1 APN 13 54053467 missense probably benign
1mM(1):Drd1 UTSW 13 54053847 missense probably damaging 1.00
H8786:Drd1 UTSW 13 54053103 missense possibly damaging 0.92
R0166:Drd1 UTSW 13 54053581 missense probably damaging 1.00
R0333:Drd1 UTSW 13 54054063 missense probably damaging 1.00
R0661:Drd1 UTSW 13 54053038 missense possibly damaging 0.90
R1022:Drd1 UTSW 13 54053314 missense probably benign 0.00
R1024:Drd1 UTSW 13 54053314 missense probably benign 0.00
R1397:Drd1 UTSW 13 54053554 missense probably damaging 1.00
R1559:Drd1 UTSW 13 54052945 missense probably damaging 0.99
R1907:Drd1 UTSW 13 54053252 missense possibly damaging 0.88
R2128:Drd1 UTSW 13 54053553 missense probably damaging 1.00
R4913:Drd1 UTSW 13 54053167 missense probably benign 0.33
R5592:Drd1 UTSW 13 54054171 start codon destroyed probably null 0.90
R5867:Drd1 UTSW 13 54054163 missense probably benign
R6966:Drd1 UTSW 13 54053545 missense probably damaging 1.00
X0028:Drd1 UTSW 13 54053793 missense probably damaging 1.00
Z1177:Drd1 UTSW 13 54052857 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAGCCCCGTTGTTGTTGATG -3'
(R):5'- TCCATGCCAAGAACTGCCAG -3'

Sequencing Primer
(F):5'- TGATGCTTACAGTCTCTATGGC -3'
(R):5'- TGCCAGACCACCACAGGTAATG -3'
Posted On2018-08-01