Incidental Mutation 'R6758:Olfr192'
List |< first << previous [record 15 of 22] next >> last >|
ID531119
Institutional Source Beutler Lab
Gene Symbol Olfr192
Ensembl Gene ENSMUSG00000059041
Gene Nameolfactory receptor 192
SynonymsMOR183-11_p, GA_x54KRFPKG5P-55327126-55326203
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6758 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59098066-59098990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59098965 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 9 (E9G)
Ref Sequence ENSEMBL: ENSMUSP00000145941 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000080251
AA Change: E9G
Predicted Effect unknown
Transcript: ENSMUST00000205727
AA Change: E9G
Predicted Effect probably damaging
Transcript: ENSMUST00000206214
AA Change: E9G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,588,475 probably null Het
Ankrd17 A T 5: 90,263,313 D1374E probably damaging Het
Cd96 C A 16: 46,118,004 V33L possibly damaging Het
Drd1 T C 13: 54,053,289 E295G probably benign Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm11595 C A 11: 99,772,540 V105L unknown Het
Gm11595 A T 11: 99,772,541 C104* probably null Het
Igsf3 T C 3: 101,425,498 Y31H probably damaging Het
Ikzf2 A T 1: 69,538,900 H483Q probably damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Myt1l T G 12: 29,842,600 Y79D possibly damaging Het
Nid2 T A 14: 19,802,483 S1086R probably damaging Het
Olfr107 A G 17: 37,405,695 D49G probably damaging Het
Olfr808 T C 10: 129,768,051 I185T probably damaging Het
Rorc A G 3: 94,387,518 N51S possibly damaging Het
Simc1 C T 13: 54,525,548 P570S possibly damaging Het
Smn1 T A 13: 100,132,438 M264K possibly damaging Het
Tiam2 A G 17: 3,518,403 D1608G probably benign Het
Tll1 C A 8: 64,041,405 probably null Het
Trim15 A G 17: 36,862,341 L284P probably benign Het
Other mutations in Olfr192
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3807:Olfr192 UTSW 16 59098843 makesense probably null
R3872:Olfr192 UTSW 16 59098761 missense unknown
R4008:Olfr192 UTSW 16 59098761 missense unknown
R4009:Olfr192 UTSW 16 59098761 missense unknown
R4011:Olfr192 UTSW 16 59098761 missense unknown
R4043:Olfr192 UTSW 16 59098761 missense unknown
R4044:Olfr192 UTSW 16 59098761 missense unknown
R4296:Olfr192 UTSW 16 59098761 missense unknown
R4300:Olfr192 UTSW 16 59098278 missense unknown
R4948:Olfr192 UTSW 16 59098977 missense probably damaging 0.99
R5411:Olfr192 UTSW 16 59098704 missense unknown
R5426:Olfr192 UTSW 16 59098302 missense possibly damaging 0.93
R5436:Olfr192 UTSW 16 59098819 missense unknown
R5597:Olfr192 UTSW 16 59098347 missense unknown
R6882:Olfr192 UTSW 16 59098627 missense unknown
R8026:Olfr192 UTSW 16 59098368 missense unknown
R8224:Olfr192 UTSW 16 59098754 missense unknown
R8313:Olfr192 UTSW 16 59098641 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCACTGTGGATGATAGGG -3'
(R):5'- CCAAGAGCCACTAAGTACTAGATG -3'

Sequencing Primer
(F):5'- CACTGTGGATGATAGGGAAGCATCC -3'
(R):5'- GCCACTAAGTACTAGATGGGTAAG -3'
Posted On2018-08-01