Incidental Mutation 'R6758:Trim15'
List |< first << previous [record 22 of 22]
ID531121
Institutional Source Beutler Lab
Gene Symbol Trim15
Ensembl Gene ENSMUSG00000050747
Gene Nametripartite motif-containing 15
Synonyms1810012B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6758 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location36860691-36867210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36862341 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 284 (L284P)
Ref Sequence ENSEMBL: ENSMUSP00000133953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025329] [ENSMUST00000053434] [ENSMUST00000123715] [ENSMUST00000124136] [ENSMUST00000130367] [ENSMUST00000144182] [ENSMUST00000174195] [ENSMUST00000179968]
Predicted Effect probably benign
Transcript: ENSMUST00000025329
AA Change: L284P

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025329
Gene: ENSMUSG00000050747
AA Change: L284P

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053434
SMART Domains Protein: ENSMUSP00000060103
Gene: ENSMUSG00000024457

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
PRY 318 370 6.18e-19 SMART
SPRY 371 545 3.03e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123715
SMART Domains Protein: ENSMUSP00000118438
Gene: ENSMUSG00000024457

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124136
SMART Domains Protein: ENSMUSP00000120764
Gene: ENSMUSG00000024457

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
PRY 121 173 6.18e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130367
SMART Domains Protein: ENSMUSP00000114896
Gene: ENSMUSG00000024457

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
PRY 318 370 6.18e-19 SMART
SPRY 371 545 3.03e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144182
SMART Domains Protein: ENSMUSP00000114565
Gene: ENSMUSG00000024457

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
PRY 318 370 6.18e-19 SMART
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156872
Predicted Effect probably benign
Transcript: ENSMUST00000173639
SMART Domains Protein: ENSMUSP00000133638
Gene: ENSMUSG00000050747

DomainStartEndE-ValueType
SCOP:d1dkza_ 15 105 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174195
AA Change: L284P

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133953
Gene: ENSMUSG00000050747
AA Change: L284P

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179968
SMART Domains Protein: ENSMUSP00000136651
Gene: ENSMUSG00000024457

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
PRY 318 370 6.18e-19 SMART
SPRY 371 545 3.03e-28 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,588,475 probably null Het
Ankrd17 A T 5: 90,263,313 D1374E probably damaging Het
Cd96 C A 16: 46,118,004 V33L possibly damaging Het
Drd1 T C 13: 54,053,289 E295G probably benign Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm11595 C A 11: 99,772,540 V105L unknown Het
Gm11595 A T 11: 99,772,541 C104* probably null Het
Igsf3 T C 3: 101,425,498 Y31H probably damaging Het
Ikzf2 A T 1: 69,538,900 H483Q probably damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Myt1l T G 12: 29,842,600 Y79D possibly damaging Het
Nid2 T A 14: 19,802,483 S1086R probably damaging Het
Olfr107 A G 17: 37,405,695 D49G probably damaging Het
Olfr192 T C 16: 59,098,965 E9G probably damaging Het
Olfr808 T C 10: 129,768,051 I185T probably damaging Het
Rorc A G 3: 94,387,518 N51S possibly damaging Het
Simc1 C T 13: 54,525,548 P570S possibly damaging Het
Smn1 T A 13: 100,132,438 M264K possibly damaging Het
Tiam2 A G 17: 3,518,403 D1608G probably benign Het
Tll1 C A 8: 64,041,405 probably null Het
Other mutations in Trim15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Trim15 APN 17 36865083 missense probably damaging 0.97
IGL02135:Trim15 APN 17 36867064 missense probably benign 0.00
IGL03024:Trim15 APN 17 36866893 missense probably damaging 1.00
R0310:Trim15 UTSW 17 36866986 missense probably damaging 1.00
R0490:Trim15 UTSW 17 36866355 missense probably benign
R0992:Trim15 UTSW 17 36865011 missense probably damaging 0.98
R1775:Trim15 UTSW 17 36865169 missense probably benign 0.15
R1957:Trim15 UTSW 17 36862323 unclassified probably benign
R3625:Trim15 UTSW 17 36866876 missense possibly damaging 0.74
R4520:Trim15 UTSW 17 36866350 missense probably benign 0.01
R4845:Trim15 UTSW 17 36866983 missense probably benign 0.00
R5644:Trim15 UTSW 17 36866821 missense probably damaging 0.99
R5838:Trim15 UTSW 17 36862840 missense probably damaging 1.00
R5930:Trim15 UTSW 17 36862360 critical splice acceptor site probably null
R7094:Trim15 UTSW 17 36862896 missense probably benign
R7849:Trim15 UTSW 17 36866872 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGGATGAGTGTCTACATGTAACTG -3'
(R):5'- ATTGTGGTCTCCCCTGTCCAAG -3'

Sequencing Primer
(F):5'- CGGAGGTCCTTGCATGCATTC -3'
(R):5'- TGTCCAAGGATAGAGGCCCTG -3'
Posted On2018-08-01