Mutagenetix > Incidental Mutation

Incidental Mutation 'R6759:Enam'

531134

Institutional Source

Beutler Lab

Gene Symbol

Enam

Ensembl Gene

ENSMUSG00000029286

Gene Name

enamelin

Synonyms

abte

MMRRC Submission

044875-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.337) question?

Stock #

R6759 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88635834-88653908 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88649550 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 278 (G278D)

Ref Sequence

ENSEMBL: ENSMUSP00000031222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]

AlphaFold

O55196

Predicted Effect

probably damaging
Transcript: ENSMUST00000031222
AA Change: G278D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: G278D

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
low complexity region	67	114	N/A	INTRINSIC
low complexity region	128	150	N/A	INTRINSIC
low complexity region	159	167	N/A	INTRINSIC
low complexity region	173	187	N/A	INTRINSIC
low complexity region	203	214	N/A	INTRINSIC
Pfam:Enamelin	216	441	5.4e-74	PFAM
Pfam:Enamelin	503	1249	1.9e-303	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199104
AA Change: G353D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: G353D

Domain	Start	End	E-Value	Type
low complexity region	100	113	N/A	INTRINSIC
low complexity region	142	189	N/A	INTRINSIC
low complexity region	203	225	N/A	INTRINSIC
low complexity region	234	242	N/A	INTRINSIC
low complexity region	248	262	N/A	INTRINSIC
low complexity region	278	289	N/A	INTRINSIC
Pfam:Enamelin	291	510	2.5e-74	PFAM
Pfam:Enamelin	550	1325	N/A	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	C	5: 113,331,692 (GRCm39)	S841G	probably benign	Het
4933427I04Rik	G	T	4: 123,753,879 (GRCm39)		probably benign	Het
Aak1	A	G	6: 86,921,399 (GRCm39)	T199A	probably damaging	Het
Acnat2	C	A	4: 49,380,254 (GRCm39)	V375L	probably benign	Het
Aldh1a7	T	C	19: 20,677,320 (GRCm39)	T434A	possibly damaging	Het
Aldh3a2	T	C	11: 61,156,088 (GRCm39)	T63A	probably benign	Het
Anxa2	T	C	9: 69,391,103 (GRCm39)	S97P	probably damaging	Het
Apip	T	C	2: 102,922,191 (GRCm39)	S186P	probably benign	Het
Apob	A	G	12: 8,061,049 (GRCm39)	K3177R	probably benign	Het
Atm	C	T	9: 53,429,859 (GRCm39)	W392*	probably null	Het
Atp8b1	T	A	18: 64,679,161 (GRCm39)	R773S	probably benign	Het
Bicdl2	T	A	17: 23,885,718 (GRCm39)		probably null	Het
Bltp1	C	T	3: 37,042,234 (GRCm39)	T2740I	possibly damaging	Het
Cacng3	G	A	7: 122,361,547 (GRCm39)		probably null	Het
Clca3a1	G	T	3: 144,455,450 (GRCm39)	L448M	probably damaging	Het
Clk4	A	G	11: 51,166,401 (GRCm39)	I94M	possibly damaging	Het
Cnot3	G	T	7: 3,654,918 (GRCm39)	V124F	probably damaging	Het
Cyp4a30b	C	T	4: 115,318,571 (GRCm39)	A426V	probably benign	Het
Dact1	T	A	12: 71,364,911 (GRCm39)	L564*	probably null	Het
Dnah8	T	A	17: 30,882,266 (GRCm39)		probably null	Het
Dock5	T	A	14: 68,033,445 (GRCm39)	T975S	probably benign	Het
Dock8	C	A	19: 25,104,848 (GRCm39)	H739Q	probably damaging	Het
Efr3b	T	A	12: 4,034,613 (GRCm39)	N186Y	probably damaging	Het
Fgl2	A	G	5: 21,578,256 (GRCm39)	D181G	probably benign	Het
Gfra3	G	T	18: 34,828,926 (GRCm39)	S156*	probably null	Het
Jam3	G	C	9: 27,013,276 (GRCm39)	T98S	probably benign	Het
Ltbp2	A	T	12: 84,834,184 (GRCm39)	I1435N	probably damaging	Het
Man2a1	G	A	17: 64,932,383 (GRCm39)	A157T	probably benign	Het
Mcm3ap	T	A	10: 76,337,148 (GRCm39)	V1361E	probably benign	Het
Nobox	A	T	6: 43,284,538 (GRCm39)	L36Q	possibly damaging	Het
Or2ag12	T	A	7: 106,277,100 (GRCm39)	M198L	probably benign	Het
Or51a10	A	G	7: 103,699,334 (GRCm39)	S76P	probably damaging	Het
Parp4	G	A	14: 56,857,947 (GRCm39)	V860I	probably benign	Het
Pim3	T	A	15: 88,747,296 (GRCm39)		probably null	Het
Ptpn13	A	T	5: 103,713,121 (GRCm39)	N1748I	possibly damaging	Het
Rad51ap2	A	G	12: 11,507,145 (GRCm39)	T356A	possibly damaging	Het
Ranbp2	C	T	10: 58,293,559 (GRCm39)	R310*	probably null	Het
Rassf5	C	T	1: 131,109,988 (GRCm39)	V190I	probably benign	Het
Rgl1	T	G	1: 152,409,281 (GRCm39)	Q481P	probably damaging	Het
Rrp1b	A	G	17: 32,276,063 (GRCm39)	T537A	probably benign	Het
Smok3c	T	A	5: 138,063,699 (GRCm39)	S395R	probably benign	Het
St3gal1	A	G	15: 66,983,195 (GRCm39)	V187A	possibly damaging	Het
Strn4	A	T	7: 16,556,978 (GRCm39)	E145V	probably damaging	Het
Tex21	T	A	12: 76,251,086 (GRCm39)		probably null	Het
Usp37	G	A	1: 74,534,908 (GRCm39)	R13*	probably null	Het
Uty	G	T	Y: 1,174,735 (GRCm39)	L222I	probably damaging	Homo
Wwp2	A	G	8: 108,267,314 (GRCm39)	T309A	probably damaging	Het
Zfp40	C	T	17: 23,395,510 (GRCm39)	R359H	possibly damaging	Het

Other mutations in Enam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Enam	APN	5	88,649,343 (GRCm39)	missense	possibly damaging	0.83
IGL01611:Enam	APN	5	88,651,608 (GRCm39)	missense	probably damaging	0.99
IGL01802:Enam	APN	5	88,651,533 (GRCm39)	missense	possibly damaging	0.93
IGL02220:Enam	APN	5	88,652,418 (GRCm39)	nonsense	probably null
IGL02371:Enam	APN	5	88,650,668 (GRCm39)	missense	probably benign	0.39
IGL02596:Enam	APN	5	88,650,885 (GRCm39)	missense	probably benign	0.01
IGL03026:Enam	APN	5	88,651,158 (GRCm39)	missense	probably benign	0.38
IGL03303:Enam	APN	5	88,652,450 (GRCm39)	missense	probably benign	0.12
opinionated	UTSW	5	88,650,885 (GRCm39)	missense	probably benign	0.04
recalcitrant	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R0200:Enam	UTSW	5	88,640,886 (GRCm39)	missense	possibly damaging	0.96
R0230:Enam	UTSW	5	88,637,514 (GRCm39)	splice site	probably benign
R0395:Enam	UTSW	5	88,649,367 (GRCm39)	missense	probably damaging	0.99
R0548:Enam	UTSW	5	88,650,964 (GRCm39)	missense	probably damaging	0.96
R0608:Enam	UTSW	5	88,640,886 (GRCm39)	missense	possibly damaging	0.96
R0724:Enam	UTSW	5	88,649,853 (GRCm39)	missense	probably damaging	1.00
R0927:Enam	UTSW	5	88,641,919 (GRCm39)	missense	possibly damaging	0.72
R1023:Enam	UTSW	5	88,649,826 (GRCm39)	missense	probably damaging	0.99
R1053:Enam	UTSW	5	88,651,878 (GRCm39)	missense	possibly damaging	0.64
R1169:Enam	UTSW	5	88,651,117 (GRCm39)	missense	probably damaging	1.00
R1230:Enam	UTSW	5	88,641,927 (GRCm39)	missense	probably damaging	0.99
R1324:Enam	UTSW	5	88,641,927 (GRCm39)	missense	possibly damaging	0.53
R1663:Enam	UTSW	5	88,651,853 (GRCm39)	missense	probably damaging	1.00
R1727:Enam	UTSW	5	88,651,853 (GRCm39)	missense	probably damaging	1.00
R1750:Enam	UTSW	5	88,651,086 (GRCm39)	missense	probably damaging	1.00
R1852:Enam	UTSW	5	88,652,324 (GRCm39)	missense	possibly damaging	0.92
R1907:Enam	UTSW	5	88,652,481 (GRCm39)	missense	possibly damaging	0.86
R2104:Enam	UTSW	5	88,649,646 (GRCm39)	missense	probably damaging	1.00
R2143:Enam	UTSW	5	88,640,779 (GRCm39)	missense	probably benign	0.02
R2196:Enam	UTSW	5	88,650,603 (GRCm39)	missense	probably damaging	0.99
R2363:Enam	UTSW	5	88,651,008 (GRCm39)	missense	probably benign	0.24
R2497:Enam	UTSW	5	88,650,553 (GRCm39)	missense	probably benign	0.13
R3615:Enam	UTSW	5	88,652,306 (GRCm39)	missense	possibly damaging	0.81
R3616:Enam	UTSW	5	88,652,306 (GRCm39)	missense	possibly damaging	0.81
R3782:Enam	UTSW	5	88,650,674 (GRCm39)	missense	probably damaging	1.00
R4067:Enam	UTSW	5	88,651,236 (GRCm39)	missense	probably damaging	1.00
R4349:Enam	UTSW	5	88,651,407 (GRCm39)	missense	probably damaging	0.99
R4604:Enam	UTSW	5	88,652,142 (GRCm39)	missense	possibly damaging	0.93
R4649:Enam	UTSW	5	88,640,827 (GRCm39)	missense	probably benign	0.02
R4702:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4703:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4704:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4705:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4714:Enam	UTSW	5	88,651,395 (GRCm39)	missense	probably damaging	1.00
R4748:Enam	UTSW	5	88,649,402 (GRCm39)	missense	probably damaging	1.00
R4838:Enam	UTSW	5	88,640,967 (GRCm39)	nonsense	probably null
R4840:Enam	UTSW	5	88,650,885 (GRCm39)	missense	probably benign	0.04
R4856:Enam	UTSW	5	88,636,593 (GRCm39)	nonsense	probably null
R4886:Enam	UTSW	5	88,636,593 (GRCm39)	nonsense	probably null
R4910:Enam	UTSW	5	88,650,173 (GRCm39)	missense	probably benign
R4911:Enam	UTSW	5	88,650,173 (GRCm39)	missense	probably benign
R6103:Enam	UTSW	5	88,650,187 (GRCm39)	missense	probably damaging	0.96
R6651:Enam	UTSW	5	88,650,776 (GRCm39)	missense	probably damaging	0.98
R7282:Enam	UTSW	5	88,650,186 (GRCm39)	missense	probably damaging	0.99
R7365:Enam	UTSW	5	88,649,347 (GRCm39)	missense	possibly damaging	0.75
R7392:Enam	UTSW	5	88,649,523 (GRCm39)	missense	probably damaging	0.99
R7483:Enam	UTSW	5	88,649,679 (GRCm39)	missense	probably damaging	1.00
R7647:Enam	UTSW	5	88,650,884 (GRCm39)	missense	probably benign	0.00
R7648:Enam	UTSW	5	88,652,016 (GRCm39)	missense	possibly damaging	0.89
R7672:Enam	UTSW	5	88,651,830 (GRCm39)	missense	possibly damaging	0.80
R7943:Enam	UTSW	5	88,636,410 (GRCm39)	splice site	probably null
R7999:Enam	UTSW	5	88,651,561 (GRCm39)	missense	probably benign
R8117:Enam	UTSW	5	88,651,385 (GRCm39)	missense	probably benign	0.00
R8419:Enam	UTSW	5	88,651,209 (GRCm39)	missense	possibly damaging	0.80
R8528:Enam	UTSW	5	88,650,078 (GRCm39)	missense	probably damaging	0.98
R8836:Enam	UTSW	5	88,639,124 (GRCm39)	critical splice donor site	probably null
R8973:Enam	UTSW	5	88,641,947 (GRCm39)	missense	possibly damaging	0.96
R9001:Enam	UTSW	5	88,637,388 (GRCm39)	missense	probably benign	0.11
R9033:Enam	UTSW	5	88,646,475 (GRCm39)	missense	probably benign	0.01
R9268:Enam	UTSW	5	88,640,778 (GRCm39)	missense	probably benign	0.01
R9723:Enam	UTSW	5	88,652,241 (GRCm39)	missense	probably damaging	1.00
X0018:Enam	UTSW	5	88,650,550 (GRCm39)	nonsense	probably null
Z1176:Enam	UTSW	5	88,640,830 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGGTCGTCCTTATTACTCAGAAG -3'
(R):5'- CAGGTCCATTCTGTCTAGGC -3'

Sequencing Primer
(F):5'- GTCGTCCTTATTACTCAGAAGAGATG -3'
(R):5'- ATTCTGTCTAGGCCCCTGGG -3'

Posted On

2018-08-01