Incidental Mutation 'R6759:Olfr693'
ID531143
Institutional Source Beutler Lab
Gene Symbol Olfr693
Ensembl Gene ENSMUSG00000051680
Gene Nameolfactory receptor 693
SynonymsGA_x6K02T2PBJ9-9055944-9054994, MOR283-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6759 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106675005-106680584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106677893 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 198 (M198L)
Ref Sequence ENSEMBL: ENSMUSP00000150203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057817] [ENSMUST00000215541]
Predicted Effect probably benign
Transcript: ENSMUST00000057817
AA Change: M198L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059679
Gene: ENSMUSG00000051680
AA Change: M198L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.2e-48 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215541
AA Change: M198L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,826 S841G probably benign Het
4932438A13Rik C T 3: 36,988,085 T2740I possibly damaging Het
4933427I04Rik G T 4: 123,860,086 probably benign Het
Aak1 A G 6: 86,944,417 T199A probably damaging Het
Acnat2 C A 4: 49,380,254 V375L probably benign Het
Aldh1a7 T C 19: 20,699,956 T434A possibly damaging Het
Aldh3a2 T C 11: 61,265,262 T63A probably benign Het
Anxa2 T C 9: 69,483,821 S97P probably damaging Het
Apip T C 2: 103,091,846 S186P probably benign Het
Apob A G 12: 8,011,049 K3177R probably benign Het
Atm C T 9: 53,518,559 W392* probably null Het
Atp8b1 T A 18: 64,546,090 R773S probably benign Het
Bicdl2 T A 17: 23,666,744 probably null Het
Cacng3 G A 7: 122,762,324 probably null Het
Clca3a1 G T 3: 144,749,689 L448M probably damaging Het
Clk4 A G 11: 51,275,574 I94M possibly damaging Het
Cnot3 G T 7: 3,651,919 V124F probably damaging Het
Cyp4a30b C T 4: 115,461,374 A426V probably benign Het
Dact1 T A 12: 71,318,137 L564* probably null Het
Dnah8 T A 17: 30,663,292 probably null Het
Dock5 T A 14: 67,795,996 T975S probably benign Het
Dock8 C A 19: 25,127,484 H739Q probably damaging Het
Efr3b T A 12: 3,984,613 N186Y probably damaging Het
Enam G A 5: 88,501,691 G278D probably damaging Het
Fgl2 A G 5: 21,373,258 D181G probably benign Het
Gfra3 G T 18: 34,695,873 S156* probably null Het
Jam3 G C 9: 27,101,980 T98S probably benign Het
Ltbp2 A T 12: 84,787,410 I1435N probably damaging Het
Man2a1 G A 17: 64,625,388 A157T probably benign Het
Mcm3ap T A 10: 76,501,314 V1361E probably benign Het
Nobox A T 6: 43,307,604 L36Q possibly damaging Het
Olfr642 A G 7: 104,050,127 S76P probably damaging Het
Parp4 G A 14: 56,620,490 V860I probably benign Het
Pim3 T A 15: 88,863,093 probably null Het
Ptpn13 A T 5: 103,565,255 N1748I possibly damaging Het
Rad51ap2 A G 12: 11,457,144 T356A possibly damaging Het
Ranbp2 C T 10: 58,457,737 R310* probably null Het
Rassf5 C T 1: 131,182,251 V190I probably benign Het
Rgl1 T G 1: 152,533,530 Q481P probably damaging Het
Rrp1b A G 17: 32,057,089 T537A probably benign Het
Smok3c T A 5: 138,065,437 S395R probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Strn4 A T 7: 16,823,053 E145V probably damaging Het
Tex21 T A 12: 76,204,312 probably null Het
Usp37 G A 1: 74,495,749 R13* probably null Het
Uty G T Y: 1,174,735 L222I probably damaging Homo
Wwp2 A G 8: 107,540,682 T309A probably damaging Het
Zfp40 C T 17: 23,176,536 R359H possibly damaging Het
Other mutations in Olfr693
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Olfr693 APN 7 106677833 missense probably damaging 1.00
IGL01135:Olfr693 APN 7 106678193 missense probably benign 0.41
IGL03247:Olfr693 APN 7 106677547 missense probably benign 0.01
R0206:Olfr693 UTSW 7 106677574 missense probably benign 0.03
R1125:Olfr693 UTSW 7 106678007 missense possibly damaging 0.46
R1873:Olfr693 UTSW 7 106678484 start codon destroyed probably damaging 1.00
R1969:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1970:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1971:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1972:Olfr693 UTSW 7 106678219 missense probably benign 0.01
R1973:Olfr693 UTSW 7 106678219 missense probably benign 0.01
R2570:Olfr693 UTSW 7 106677667 missense probably benign 0.41
R3975:Olfr693 UTSW 7 106677785 missense probably damaging 1.00
R4840:Olfr693 UTSW 7 106678123 missense probably damaging 1.00
R5569:Olfr693 UTSW 7 106678483 start codon destroyed probably null 1.00
R6842:Olfr693 UTSW 7 106677886 missense probably damaging 1.00
R7108:Olfr693 UTSW 7 106678048 missense probably benign 0.03
R7565:Olfr693 UTSW 7 106678126 missense probably damaging 1.00
R7800:Olfr693 UTSW 7 106677574 missense probably benign 0.03
X0025:Olfr693 UTSW 7 106678249 missense probably damaging 1.00
Z1088:Olfr693 UTSW 7 106678457 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACTGTGAGAGGCCCATAG -3'
(R):5'- GGCCATTTGTCATCCATTGAAC -3'

Sequencing Primer
(F):5'- CTGTGAGAGGCCCATAGTACATC -3'
(R):5'- TTCATGAGGCCAAGCATCTG -3'
Posted On2018-08-01