Incidental Mutation 'R6759:Wwp2'
ID531145
Institutional Source Beutler Lab
Gene Symbol Wwp2
Ensembl Gene ENSMUSG00000031930
Gene NameWW domain containing E3 ubiquitin protein ligase 2
SynonymsAIP2, 1300010O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R6759 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location107436365-107558595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107540682 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 309 (T309A)
Ref Sequence ENSEMBL: ENSMUSP00000148679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166615] [ENSMUST00000212205] [ENSMUST00000212543]
Predicted Effect probably damaging
Transcript: ENSMUST00000166615
AA Change: T355A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132224
Gene: ENSMUSG00000031930
AA Change: T355A

DomainStartEndE-ValueType
C2 19 115 1.52e-6 SMART
low complexity region 188 208 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
WW 301 330 4.61e-8 SMART
WW 331 363 4.33e-13 SMART
WW 406 437 2.86e-13 SMART
WW 445 477 3.6e-10 SMART
HECTc 534 870 3.24e-201 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212063
Predicted Effect probably damaging
Transcript: ENSMUST00000212205
AA Change: T309A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212543
Meta Mutation Damage Score 0.3300 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body size, domed skull, short snout, twisted snout and overgrown mandibular incisors. Mice homozygous for a different knock-out allele exhibit increased sensitivity to pIpC-treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,826 S841G probably benign Het
4932438A13Rik C T 3: 36,988,085 T2740I possibly damaging Het
4933427I04Rik G T 4: 123,860,086 probably benign Het
Aak1 A G 6: 86,944,417 T199A probably damaging Het
Acnat2 C A 4: 49,380,254 V375L probably benign Het
Aldh1a7 T C 19: 20,699,956 T434A possibly damaging Het
Aldh3a2 T C 11: 61,265,262 T63A probably benign Het
Anxa2 T C 9: 69,483,821 S97P probably damaging Het
Apip T C 2: 103,091,846 S186P probably benign Het
Apob A G 12: 8,011,049 K3177R probably benign Het
Atm C T 9: 53,518,559 W392* probably null Het
Atp8b1 T A 18: 64,546,090 R773S probably benign Het
Bicdl2 T A 17: 23,666,744 probably null Het
Cacng3 G A 7: 122,762,324 probably null Het
Clca3a1 G T 3: 144,749,689 L448M probably damaging Het
Clk4 A G 11: 51,275,574 I94M possibly damaging Het
Cnot3 G T 7: 3,651,919 V124F probably damaging Het
Cyp4a30b C T 4: 115,461,374 A426V probably benign Het
Dact1 T A 12: 71,318,137 L564* probably null Het
Dnah8 T A 17: 30,663,292 probably null Het
Dock5 T A 14: 67,795,996 T975S probably benign Het
Dock8 C A 19: 25,127,484 H739Q probably damaging Het
Efr3b T A 12: 3,984,613 N186Y probably damaging Het
Enam G A 5: 88,501,691 G278D probably damaging Het
Fgl2 A G 5: 21,373,258 D181G probably benign Het
Gfra3 G T 18: 34,695,873 S156* probably null Het
Jam3 G C 9: 27,101,980 T98S probably benign Het
Ltbp2 A T 12: 84,787,410 I1435N probably damaging Het
Man2a1 G A 17: 64,625,388 A157T probably benign Het
Mcm3ap T A 10: 76,501,314 V1361E probably benign Het
Nobox A T 6: 43,307,604 L36Q possibly damaging Het
Olfr642 A G 7: 104,050,127 S76P probably damaging Het
Olfr693 T A 7: 106,677,893 M198L probably benign Het
Parp4 G A 14: 56,620,490 V860I probably benign Het
Pim3 T A 15: 88,863,093 probably null Het
Ptpn13 A T 5: 103,565,255 N1748I possibly damaging Het
Rad51ap2 A G 12: 11,457,144 T356A possibly damaging Het
Ranbp2 C T 10: 58,457,737 R310* probably null Het
Rassf5 C T 1: 131,182,251 V190I probably benign Het
Rgl1 T G 1: 152,533,530 Q481P probably damaging Het
Rrp1b A G 17: 32,057,089 T537A probably benign Het
Smok3c T A 5: 138,065,437 S395R probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Strn4 A T 7: 16,823,053 E145V probably damaging Het
Tex21 T A 12: 76,204,312 probably null Het
Usp37 G A 1: 74,495,749 R13* probably null Het
Uty G T Y: 1,174,735 L222I probably damaging Homo
Zfp40 C T 17: 23,176,536 R359H possibly damaging Het
Other mutations in Wwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Wwp2 APN 8 107533291 critical splice donor site probably null
IGL01411:Wwp2 APN 8 107506345 missense probably benign 0.07
IGL01503:Wwp2 APN 8 107549781 missense probably damaging 0.97
IGL01543:Wwp2 APN 8 107483368 missense probably damaging 1.00
IGL01998:Wwp2 APN 8 107549521 missense probably damaging 1.00
IGL02020:Wwp2 APN 8 107556495 missense probably damaging 1.00
IGL02089:Wwp2 APN 8 107554057 missense probably damaging 1.00
IGL02131:Wwp2 APN 8 107552318 missense probably damaging 0.99
IGL02352:Wwp2 APN 8 107540646 nonsense probably null
IGL02359:Wwp2 APN 8 107540646 nonsense probably null
IGL02419:Wwp2 APN 8 107549815 missense probably damaging 1.00
IGL02528:Wwp2 APN 8 107554467 missense probably benign 0.06
R0639:Wwp2 UTSW 8 107517946 missense probably benign 0.01
R0834:Wwp2 UTSW 8 107556796 splice site probably benign
R1573:Wwp2 UTSW 8 107548489 missense probably damaging 1.00
R1653:Wwp2 UTSW 8 107483410 missense possibly damaging 0.49
R1782:Wwp2 UTSW 8 107506399 frame shift probably null
R1941:Wwp2 UTSW 8 107517915 missense probably benign
R2483:Wwp2 UTSW 8 107548535 missense probably damaging 1.00
R4014:Wwp2 UTSW 8 107485621 missense probably benign 0.03
R4118:Wwp2 UTSW 8 107545459 missense probably benign 0.00
R4402:Wwp2 UTSW 8 107457978 missense probably benign 0.08
R5042:Wwp2 UTSW 8 107548485 missense possibly damaging 0.95
R5117:Wwp2 UTSW 8 107554062 missense possibly damaging 0.86
R5413:Wwp2 UTSW 8 107555078 missense probably damaging 1.00
R6175:Wwp2 UTSW 8 107483407 missense possibly damaging 0.95
R6232:Wwp2 UTSW 8 107506345 missense probably benign 0.03
R6323:Wwp2 UTSW 8 107540671 missense probably damaging 1.00
R6941:Wwp2 UTSW 8 107548502 missense probably damaging 1.00
R7043:Wwp2 UTSW 8 107457900 missense probably benign 0.00
R7109:Wwp2 UTSW 8 107483356 missense probably benign 0.28
R7457:Wwp2 UTSW 8 107517960 missense probably benign 0.05
R8027:Wwp2 UTSW 8 107555477 missense probably damaging 1.00
X0066:Wwp2 UTSW 8 107518023 missense probably benign
Z1088:Wwp2 UTSW 8 107555087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGGTCCTAGGTCATGTGCTC -3'
(R):5'- AGCAAGCCGTCTACACTGTG -3'

Sequencing Primer
(F):5'- TCACTGTGGCCGAAGCAATTC -3'
(R):5'- TACACTGTGTGCGGCTGC -3'
Posted On2018-08-01