Incidental Mutation 'R6759:Ranbp2'
ID531150
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6759 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 58457737 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 310 (R310*)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect probably null
Transcript: ENSMUST00000003310
AA Change: R310*
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: R310*

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220131
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,826 S841G probably benign Het
4932438A13Rik C T 3: 36,988,085 T2740I possibly damaging Het
4933427I04Rik G T 4: 123,860,086 probably benign Het
Aak1 A G 6: 86,944,417 T199A probably damaging Het
Acnat2 C A 4: 49,380,254 V375L probably benign Het
Aldh1a7 T C 19: 20,699,956 T434A possibly damaging Het
Aldh3a2 T C 11: 61,265,262 T63A probably benign Het
Anxa2 T C 9: 69,483,821 S97P probably damaging Het
Apip T C 2: 103,091,846 S186P probably benign Het
Apob A G 12: 8,011,049 K3177R probably benign Het
Atm C T 9: 53,518,559 W392* probably null Het
Atp8b1 T A 18: 64,546,090 R773S probably benign Het
Bicdl2 T A 17: 23,666,744 probably null Het
Cacng3 G A 7: 122,762,324 probably null Het
Clca3a1 G T 3: 144,749,689 L448M probably damaging Het
Clk4 A G 11: 51,275,574 I94M possibly damaging Het
Cnot3 G T 7: 3,651,919 V124F probably damaging Het
Cyp4a30b C T 4: 115,461,374 A426V probably benign Het
Dact1 T A 12: 71,318,137 L564* probably null Het
Dnah8 T A 17: 30,663,292 probably null Het
Dock5 T A 14: 67,795,996 T975S probably benign Het
Dock8 C A 19: 25,127,484 H739Q probably damaging Het
Efr3b T A 12: 3,984,613 N186Y probably damaging Het
Enam G A 5: 88,501,691 G278D probably damaging Het
Fgl2 A G 5: 21,373,258 D181G probably benign Het
Gfra3 G T 18: 34,695,873 S156* probably null Het
Jam3 G C 9: 27,101,980 T98S probably benign Het
Ltbp2 A T 12: 84,787,410 I1435N probably damaging Het
Man2a1 G A 17: 64,625,388 A157T probably benign Het
Mcm3ap T A 10: 76,501,314 V1361E probably benign Het
Nobox A T 6: 43,307,604 L36Q possibly damaging Het
Olfr642 A G 7: 104,050,127 S76P probably damaging Het
Olfr693 T A 7: 106,677,893 M198L probably benign Het
Parp4 G A 14: 56,620,490 V860I probably benign Het
Pim3 T A 15: 88,863,093 probably null Het
Ptpn13 A T 5: 103,565,255 N1748I possibly damaging Het
Rad51ap2 A G 12: 11,457,144 T356A possibly damaging Het
Rassf5 C T 1: 131,182,251 V190I probably benign Het
Rgl1 T G 1: 152,533,530 Q481P probably damaging Het
Rrp1b A G 17: 32,057,089 T537A probably benign Het
Smok3c T A 5: 138,065,437 S395R probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Strn4 A T 7: 16,823,053 E145V probably damaging Het
Tex21 T A 12: 76,204,312 probably null Het
Usp37 G A 1: 74,495,749 R13* probably null Het
Uty G T Y: 1,174,735 L222I probably damaging Homo
Wwp2 A G 8: 107,540,682 T309A probably damaging Het
Zfp40 C T 17: 23,176,536 R359H possibly damaging Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7083:Ranbp2 UTSW 10 58479230 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
R7424:Ranbp2 UTSW 10 58479194 missense probably damaging 0.98
R7727:Ranbp2 UTSW 10 58455438 missense probably benign 0.09
R7795:Ranbp2 UTSW 10 58483907 nonsense probably null
R7812:Ranbp2 UTSW 10 58467402 missense probably benign
R7845:Ranbp2 UTSW 10 58447022 missense probably damaging 1.00
R7875:Ranbp2 UTSW 10 58478455 nonsense probably null
R7958:Ranbp2 UTSW 10 58478455 nonsense probably null
R8022:Ranbp2 UTSW 10 58485861 missense possibly damaging 0.53
R8050:Ranbp2 UTSW 10 58479619 missense probably damaging 0.99
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Z1176:Ranbp2 UTSW 10 58461886 missense probably damaging 1.00
Z1177:Ranbp2 UTSW 10 58493891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGGACTGCCTGTTTACTC -3'
(R):5'- GCATTAACGCCTGCTTCACC -3'

Sequencing Primer
(F):5'- AGTGCTCTTCAGTCTGTG -3'
(R):5'- CAATGCACTGACCTTGTTAGAG -3'
Posted On2018-08-01