Incidental Mutation 'R6759:Rad51ap2'
ID 531156
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 044875-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6759 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11507145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 356 (T356A)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect possibly damaging
Transcript: ENSMUST00000124065
AA Change: T356A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: T356A

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,331,692 (GRCm39) S841G probably benign Het
4933427I04Rik G T 4: 123,753,879 (GRCm39) probably benign Het
Aak1 A G 6: 86,921,399 (GRCm39) T199A probably damaging Het
Acnat2 C A 4: 49,380,254 (GRCm39) V375L probably benign Het
Aldh1a7 T C 19: 20,677,320 (GRCm39) T434A possibly damaging Het
Aldh3a2 T C 11: 61,156,088 (GRCm39) T63A probably benign Het
Anxa2 T C 9: 69,391,103 (GRCm39) S97P probably damaging Het
Apip T C 2: 102,922,191 (GRCm39) S186P probably benign Het
Apob A G 12: 8,061,049 (GRCm39) K3177R probably benign Het
Atm C T 9: 53,429,859 (GRCm39) W392* probably null Het
Atp8b1 T A 18: 64,679,161 (GRCm39) R773S probably benign Het
Bicdl2 T A 17: 23,885,718 (GRCm39) probably null Het
Bltp1 C T 3: 37,042,234 (GRCm39) T2740I possibly damaging Het
Cacng3 G A 7: 122,361,547 (GRCm39) probably null Het
Clca3a1 G T 3: 144,455,450 (GRCm39) L448M probably damaging Het
Clk4 A G 11: 51,166,401 (GRCm39) I94M possibly damaging Het
Cnot3 G T 7: 3,654,918 (GRCm39) V124F probably damaging Het
Cyp4a30b C T 4: 115,318,571 (GRCm39) A426V probably benign Het
Dact1 T A 12: 71,364,911 (GRCm39) L564* probably null Het
Dnah8 T A 17: 30,882,266 (GRCm39) probably null Het
Dock5 T A 14: 68,033,445 (GRCm39) T975S probably benign Het
Dock8 C A 19: 25,104,848 (GRCm39) H739Q probably damaging Het
Efr3b T A 12: 4,034,613 (GRCm39) N186Y probably damaging Het
Enam G A 5: 88,649,550 (GRCm39) G278D probably damaging Het
Fgl2 A G 5: 21,578,256 (GRCm39) D181G probably benign Het
Gfra3 G T 18: 34,828,926 (GRCm39) S156* probably null Het
Jam3 G C 9: 27,013,276 (GRCm39) T98S probably benign Het
Ltbp2 A T 12: 84,834,184 (GRCm39) I1435N probably damaging Het
Man2a1 G A 17: 64,932,383 (GRCm39) A157T probably benign Het
Mcm3ap T A 10: 76,337,148 (GRCm39) V1361E probably benign Het
Nobox A T 6: 43,284,538 (GRCm39) L36Q possibly damaging Het
Or2ag12 T A 7: 106,277,100 (GRCm39) M198L probably benign Het
Or51a10 A G 7: 103,699,334 (GRCm39) S76P probably damaging Het
Parp4 G A 14: 56,857,947 (GRCm39) V860I probably benign Het
Pim3 T A 15: 88,747,296 (GRCm39) probably null Het
Ptpn13 A T 5: 103,713,121 (GRCm39) N1748I possibly damaging Het
Ranbp2 C T 10: 58,293,559 (GRCm39) R310* probably null Het
Rassf5 C T 1: 131,109,988 (GRCm39) V190I probably benign Het
Rgl1 T G 1: 152,409,281 (GRCm39) Q481P probably damaging Het
Rrp1b A G 17: 32,276,063 (GRCm39) T537A probably benign Het
Smok3c T A 5: 138,063,699 (GRCm39) S395R probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Strn4 A T 7: 16,556,978 (GRCm39) E145V probably damaging Het
Tex21 T A 12: 76,251,086 (GRCm39) probably null Het
Usp37 G A 1: 74,534,908 (GRCm39) R13* probably null Het
Uty G T Y: 1,174,735 (GRCm39) L222I probably damaging Homo
Wwp2 A G 8: 108,267,314 (GRCm39) T309A probably damaging Het
Zfp40 C T 17: 23,395,510 (GRCm39) R359H possibly damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCCCAAAATAGACCGAATGCTAAG -3'
(R):5'- GAAAATGCATCCCTCTTCTGATTC -3'

Sequencing Primer
(F):5'- CCGAATGCTAAGAAACAAAAGTTAC -3'
(R):5'- ATGCATCCCTCTTCTGATTCCCTATC -3'
Posted On 2018-08-01