Incidental Mutation 'R6759:Dact1'
ID531157
Institutional Source Beutler Lab
Gene Symbol Dact1
Ensembl Gene ENSMUSG00000044548
Gene Namedishevelled-binding antagonist of beta-catenin 1
SynonymsFrodo, Dapper1, Frodo1, THYEX3, Frd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6759 (G1)
Quality Score175.009
Status Validated
Chromosome12
Chromosomal Location71309884-71320107 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 71318137 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 564 (L564*)
Ref Sequence ENSEMBL: ENSMUSP00000117169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061273] [ENSMUST00000150639]
Predicted Effect probably null
Transcript: ENSMUST00000061273
AA Change: L527*
SMART Domains Protein: ENSMUSP00000058943
Gene: ENSMUSG00000044548
AA Change: L527*

DomainStartEndE-ValueType
Pfam:Dapper 39 206 4.1e-83 PFAM
Pfam:Dapper 204 778 7.8e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132822
Predicted Effect probably null
Transcript: ENSMUST00000150639
AA Change: L564*
SMART Domains Protein: ENSMUSP00000117169
Gene: ENSMUSG00000044548
AA Change: L564*

DomainStartEndE-ValueType
Pfam:Dapper 39 815 1.4e-240 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this mRNA from xenopus embryos resulted in loss of notochord and head structures, and mice lacking this gene died shortly after birth from severe posterior malformations. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, abnormal embryogenesis, blind-ended colons, and abnormal renal/urinary system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,826 S841G probably benign Het
4932438A13Rik C T 3: 36,988,085 T2740I possibly damaging Het
4933427I04Rik G T 4: 123,860,086 probably benign Het
Aak1 A G 6: 86,944,417 T199A probably damaging Het
Acnat2 C A 4: 49,380,254 V375L probably benign Het
Aldh1a7 T C 19: 20,699,956 T434A possibly damaging Het
Aldh3a2 T C 11: 61,265,262 T63A probably benign Het
Anxa2 T C 9: 69,483,821 S97P probably damaging Het
Apip T C 2: 103,091,846 S186P probably benign Het
Apob A G 12: 8,011,049 K3177R probably benign Het
Atm C T 9: 53,518,559 W392* probably null Het
Atp8b1 T A 18: 64,546,090 R773S probably benign Het
Bicdl2 T A 17: 23,666,744 probably null Het
Cacng3 G A 7: 122,762,324 probably null Het
Clca3a1 G T 3: 144,749,689 L448M probably damaging Het
Clk4 A G 11: 51,275,574 I94M possibly damaging Het
Cnot3 G T 7: 3,651,919 V124F probably damaging Het
Cyp4a30b C T 4: 115,461,374 A426V probably benign Het
Dnah8 T A 17: 30,663,292 probably null Het
Dock5 T A 14: 67,795,996 T975S probably benign Het
Dock8 C A 19: 25,127,484 H739Q probably damaging Het
Efr3b T A 12: 3,984,613 N186Y probably damaging Het
Enam G A 5: 88,501,691 G278D probably damaging Het
Fgl2 A G 5: 21,373,258 D181G probably benign Het
Gfra3 G T 18: 34,695,873 S156* probably null Het
Jam3 G C 9: 27,101,980 T98S probably benign Het
Ltbp2 A T 12: 84,787,410 I1435N probably damaging Het
Man2a1 G A 17: 64,625,388 A157T probably benign Het
Mcm3ap T A 10: 76,501,314 V1361E probably benign Het
Nobox A T 6: 43,307,604 L36Q possibly damaging Het
Olfr642 A G 7: 104,050,127 S76P probably damaging Het
Olfr693 T A 7: 106,677,893 M198L probably benign Het
Parp4 G A 14: 56,620,490 V860I probably benign Het
Pim3 T A 15: 88,863,093 probably null Het
Ptpn13 A T 5: 103,565,255 N1748I possibly damaging Het
Rad51ap2 A G 12: 11,457,144 T356A possibly damaging Het
Ranbp2 C T 10: 58,457,737 R310* probably null Het
Rassf5 C T 1: 131,182,251 V190I probably benign Het
Rgl1 T G 1: 152,533,530 Q481P probably damaging Het
Rrp1b A G 17: 32,057,089 T537A probably benign Het
Smok3c T A 5: 138,065,437 S395R probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Strn4 A T 7: 16,823,053 E145V probably damaging Het
Tex21 T A 12: 76,204,312 probably null Het
Usp37 G A 1: 74,495,749 R13* probably null Het
Uty G T Y: 1,174,735 L222I probably damaging Homo
Wwp2 A G 8: 107,540,682 T309A probably damaging Het
Zfp40 C T 17: 23,176,536 R359H possibly damaging Het
Other mutations in Dact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Dact1 APN 12 71317483 missense probably damaging 1.00
R0930:Dact1 UTSW 12 71318460 missense probably damaging 1.00
R1590:Dact1 UTSW 12 71317575 missense probably benign 0.34
R1669:Dact1 UTSW 12 71318773 missense probably damaging 1.00
R1694:Dact1 UTSW 12 71312777 missense probably damaging 1.00
R1826:Dact1 UTSW 12 71318344 missense probably damaging 1.00
R4398:Dact1 UTSW 12 71317185 missense probably damaging 1.00
R5028:Dact1 UTSW 12 71318573 nonsense probably null
R5917:Dact1 UTSW 12 71318682 missense possibly damaging 0.75
R6432:Dact1 UTSW 12 71318553 missense probably damaging 1.00
R6473:Dact1 UTSW 12 71317698 missense probably benign 0.00
R6823:Dact1 UTSW 12 71317939 missense probably benign 0.10
R7564:Dact1 UTSW 12 71318551 missense probably damaging 1.00
R7776:Dact1 UTSW 12 71317914 missense probably benign
X0025:Dact1 UTSW 12 71317852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCGCAGAAGAACAGCC -3'
(R):5'- TTCTTCGTAGGAGACCTCGG -3'

Sequencing Primer
(F):5'- GCAGAAGAACAGCCTCCAGG -3'
(R):5'- GATTTCCACCGCCGGTAGTC -3'
Posted On2018-08-01