Incidental Mutation 'R6760:Crispld1'
ID 531174
Institutional Source Beutler Lab
Gene Symbol Crispld1
Ensembl Gene ENSMUSG00000025776
Gene Name cysteine-rich secretory protein LCCL domain containing 1
Synonyms Cocoacrisp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R6760 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 17727045-17766344 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 17750801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 355 (V355G)
Ref Sequence ENSEMBL: ENSMUSP00000124095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095075] [ENSMUST00000159958] [ENSMUST00000160305]
AlphaFold Q8CGD2
Predicted Effect possibly damaging
Transcript: ENSMUST00000095075
AA Change: V355G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092686
Gene: ENSMUSG00000025776
AA Change: V355G

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159958
AA Change: V355G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124095
Gene: ENSMUSG00000025776
AA Change: V355G

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160305
SMART Domains Protein: ENSMUSP00000123800
Gene: ENSMUSG00000025776

DomainStartEndE-ValueType
SCP 60 162 1.26e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189853
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C A 4: 40,180,210 C370* probably null Het
Akap2 T C 4: 57,856,026 W493R probably damaging Het
Akap6 C T 12: 53,139,778 S1325L probably damaging Het
Atp2a3 A G 11: 72,982,740 D813G probably damaging Het
Baz2b T A 2: 59,962,432 I451F probably benign Het
Calm2 T C 17: 87,435,695 D65G probably benign Het
Cdh23 C T 10: 60,306,168 V3049M probably damaging Het
Cfap46 A G 7: 139,652,440 L869P probably damaging Het
Chrna9 T A 5: 65,971,228 Y260N probably damaging Het
Clock G A 5: 76,226,976 P782L unknown Het
Coro2a A G 4: 46,540,572 M449T probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Gpr37 T C 6: 25,669,169 I559V probably benign Het
Grik5 A G 7: 25,058,939 probably null Het
Itga8 T C 2: 12,301,640 Y48C probably damaging Het
Manba T C 3: 135,542,451 V367A probably damaging Het
Mrgpra1 G A 7: 47,335,041 R297W probably benign Het
Myh7b C A 2: 155,620,118 Y311* probably null Het
Nmd3 T A 3: 69,746,837 probably null Het
Olfr1034 T A 2: 86,047,014 C177* probably null Het
Pcdhb11 A T 18: 37,421,584 probably benign Het
Plcb1 C T 2: 135,472,060 T1144M possibly damaging Het
Sfrp1 A G 8: 23,411,888 D35G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Timeless A G 10: 128,246,117 K537R probably benign Het
Tnrc6a T A 7: 123,171,999 V1004E probably damaging Het
Tubb4a T C 17: 57,080,796 E410G possibly damaging Het
U2surp G A 9: 95,493,711 A143V probably benign Het
Vmn2r118 T A 17: 55,592,714 H730L possibly damaging Het
Vmn2r28 G A 7: 5,481,230 T657I probably damaging Het
Ybey A T 10: 76,468,199 N56K probably benign Het
Other mutations in Crispld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Crispld1 APN 1 17746801 missense probably benign 0.21
IGL01610:Crispld1 APN 1 17746725 splice site probably null
IGL01991:Crispld1 APN 1 17753017 missense probably benign
IGL02004:Crispld1 APN 1 17747520 missense probably damaging 1.00
IGL02178:Crispld1 APN 1 17762103 splice site probably benign
IGL02200:Crispld1 APN 1 17750333 unclassified probably benign
IGL02251:Crispld1 APN 1 17728840 missense probably benign 0.06
IGL02506:Crispld1 APN 1 17756305 missense probably damaging 0.99
IGL02883:Crispld1 APN 1 17746789 missense possibly damaging 0.87
IGL03310:Crispld1 APN 1 17745477 splice site probably benign
milliliter UTSW 1 17750801 missense possibly damaging 0.81
Spoonful UTSW 1 17762141 missense probably damaging 1.00
R0068:Crispld1 UTSW 1 17752988 missense possibly damaging 0.89
R0324:Crispld1 UTSW 1 17749591 missense probably benign
R0542:Crispld1 UTSW 1 17746768 missense possibly damaging 0.75
R1117:Crispld1 UTSW 1 17749622 missense probably benign 0.03
R1157:Crispld1 UTSW 1 17745363 missense possibly damaging 0.70
R1585:Crispld1 UTSW 1 17750800 missense possibly damaging 0.68
R1630:Crispld1 UTSW 1 17728798 missense probably benign
R2081:Crispld1 UTSW 1 17762179 missense probably damaging 0.99
R2143:Crispld1 UTSW 1 17749636 missense probably benign
R2472:Crispld1 UTSW 1 17745828 missense probably null 0.12
R2520:Crispld1 UTSW 1 17750776 missense probably damaging 1.00
R4476:Crispld1 UTSW 1 17747510 missense probably damaging 1.00
R4486:Crispld1 UTSW 1 17752878 missense probably benign 0.01
R4779:Crispld1 UTSW 1 17749607 missense probably benign
R5508:Crispld1 UTSW 1 17752983 missense probably damaging 1.00
R5568:Crispld1 UTSW 1 17750271 missense probably benign 0.01
R6155:Crispld1 UTSW 1 17753017 missense probably benign
R6252:Crispld1 UTSW 1 17749507 missense probably benign 0.00
R6361:Crispld1 UTSW 1 17762231 missense probably damaging 0.99
R6617:Crispld1 UTSW 1 17728662 missense probably benign 0.02
R6961:Crispld1 UTSW 1 17762141 missense probably damaging 1.00
R7278:Crispld1 UTSW 1 17752878 missense probably benign 0.01
R7403:Crispld1 UTSW 1 17747596 missense probably damaging 1.00
R7592:Crispld1 UTSW 1 17728766 missense possibly damaging 0.64
R7837:Crispld1 UTSW 1 17728730 missense probably benign 0.42
R8906:Crispld1 UTSW 1 17750771 missense possibly damaging 0.95
R9331:Crispld1 UTSW 1 17762230 missense probably damaging 0.99
R9477:Crispld1 UTSW 1 17746732 missense probably benign 0.44
Z1088:Crispld1 UTSW 1 17764076 missense probably benign
Z1176:Crispld1 UTSW 1 17728613 start gained probably benign
Z1176:Crispld1 UTSW 1 17752851 missense possibly damaging 0.60
Z1177:Crispld1 UTSW 1 17764092 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTGCAACCTTGAAAATGTTGTATC -3'
(R):5'- GCACAAAGATCCCCATCATTTTATG -3'

Sequencing Primer
(F):5'- GTGGAAATTGCAACTTATATCAAGAG -3'
(R):5'- CTTCTATGATTGGGTCAAAGA -3'
Posted On 2018-08-01