Mutagenetix > Incidental Mutation

Incidental Mutation 'R6760:Itga8'

531177

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R6760 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12301640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 48 (Y48C)

Ref Sequence

ENSEMBL: ENSMUSP00000134154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000028106
AA Change: Y48C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: Y48C

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130548

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141477

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148089

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150037

Predicted Effect

probably damaging
Transcript: ENSMUST00000172791
AA Change: Y48C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: Y48C

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Meta Mutation Damage Score

0.4250

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco1	C	A	4: 40,180,210	C370*	probably null	Het
Akap2	T	C	4: 57,856,026	W493R	probably damaging	Het
Akap6	C	T	12: 53,139,778	S1325L	probably damaging	Het
Atp2a3	A	G	11: 72,982,740	D813G	probably damaging	Het
Baz2b	T	A	2: 59,962,432	I451F	probably benign	Het
Calm2	T	C	17: 87,435,695	D65G	probably benign	Het
Cdh23	C	T	10: 60,306,168	V3049M	probably damaging	Het
Cfap46	A	G	7: 139,652,440	L869P	probably damaging	Het
Chrna9	T	A	5: 65,971,228	Y260N	probably damaging	Het
Clock	G	A	5: 76,226,976	P782L	unknown	Het
Coro2a	A	G	4: 46,540,572	M449T	probably benign	Het
Crispld1	T	G	1: 17,750,801	V355G	possibly damaging	Het
Dnah7c	C	A	1: 46,649,340	T1890K	probably benign	Het
Dnah7c	A	G	1: 46,649,351	S1894G	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Gpr37	T	C	6: 25,669,169	I559V	probably benign	Het
Grik5	A	G	7: 25,058,939		probably null	Het
Manba	T	C	3: 135,542,451	V367A	probably damaging	Het
Mrgpra1	G	A	7: 47,335,041	R297W	probably benign	Het
Myh7b	C	A	2: 155,620,118	Y311*	probably null	Het
Nmd3	T	A	3: 69,746,837		probably null	Het
Olfr1034	T	A	2: 86,047,014	C177*	probably null	Het
Pcdhb11	A	T	18: 37,421,584		probably benign	Het
Plcb1	C	T	2: 135,472,060	T1144M	possibly damaging	Het
Sfrp1	A	G	8: 23,411,888	D35G	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Timeless	A	G	10: 128,246,117	K537R	probably benign	Het
Tnrc6a	T	A	7: 123,171,999	V1004E	probably damaging	Het
Tubb4a	T	C	17: 57,080,796	E410G	possibly damaging	Het
U2surp	G	A	9: 95,493,711	A143V	probably benign	Het
Vmn2r118	T	A	17: 55,592,714	H730L	possibly damaging	Het
Vmn2r28	G	A	7: 5,481,230	T657I	probably damaging	Het
Ybey	A	T	10: 76,468,199	N56K	probably benign	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCACATCTATTTAGCATAAGTCAGGAG -3'
(R):5'- AGAGGACTGTCACTGTGGAC -3'

Sequencing Primer
(F):5'- GAGCAGAATCCGACCCG -3'
(R):5'- TGTCACTGTGGACGCTCCTAG -3'

Posted On

2018-08-01