Mutagenetix > Incidental Mutations

Incidental Mutation 'R6760:Cfap46'

531194

Institutional Source

Beutler Lab

Gene Symbol

Cfap46

Ensembl Gene

ENSMUSG00000049571

Gene Name

cilia and flagella associated protein 46

Synonyms

9330101J02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6760 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139600951-139683817 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139652440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 869 (L869P)

Ref Sequence

ENSEMBL: ENSMUSP00000120186 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]

AlphaFold

E9Q2C0

Predicted Effect

probably damaging
Transcript: ENSMUST00000129990
AA Change: L869P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: L869P

Domain	Start	End	E-Value	Type
Blast:TPR	175	207	7e-11	BLAST
Blast:TPR	426	459	1e-11	BLAST
low complexity region	868	879	N/A	INTRINSIC
Blast:TPR	936	969	2e-7	BLAST
Blast:TPR	1112	1145	1e-9	BLAST
coiled coil region	1347	1423	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140820

SMART Domains

Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

Domain	Start	End	E-Value	Type
Blast:TPR	175	208	5e-11	BLAST
Blast:TPR	426	459	8e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155075

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156116

Meta Mutation Damage Score

0.2280

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco1	C	A	4: 40,180,210	C370*	probably null	Het
Akap2	T	C	4: 57,856,026	W493R	probably damaging	Het
Akap6	C	T	12: 53,139,778	S1325L	probably damaging	Het
Atp2a3	A	G	11: 72,982,740	D813G	probably damaging	Het
Baz2b	T	A	2: 59,962,432	I451F	probably benign	Het
Calm2	T	C	17: 87,435,695	D65G	probably benign	Het
Cdh23	C	T	10: 60,306,168	V3049M	probably damaging	Het
Chrna9	T	A	5: 65,971,228	Y260N	probably damaging	Het
Clock	G	A	5: 76,226,976	P782L	unknown	Het
Coro2a	A	G	4: 46,540,572	M449T	probably benign	Het
Crispld1	T	G	1: 17,750,801	V355G	possibly damaging	Het
Dnah7c	C	A	1: 46,649,340	T1890K	probably benign	Het
Dnah7c	A	G	1: 46,649,351	S1894G	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Gpr37	T	C	6: 25,669,169	I559V	probably benign	Het
Grik5	A	G	7: 25,058,939		probably null	Het
Itga8	T	C	2: 12,301,640	Y48C	probably damaging	Het
Manba	T	C	3: 135,542,451	V367A	probably damaging	Het
Mrgpra1	G	A	7: 47,335,041	R297W	probably benign	Het
Myh7b	C	A	2: 155,620,118	Y311*	probably null	Het
Nmd3	T	A	3: 69,746,837		probably null	Het
Olfr1034	T	A	2: 86,047,014	C177*	probably null	Het
Pcdhb11	A	T	18: 37,421,584		probably benign	Het
Plcb1	C	T	2: 135,472,060	T1144M	possibly damaging	Het
Sfrp1	A	G	8: 23,411,888	D35G	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Timeless	A	G	10: 128,246,117	K537R	probably benign	Het
Tnrc6a	T	A	7: 123,171,999	V1004E	probably damaging	Het
Tubb4a	T	C	17: 57,080,796	E410G	possibly damaging	Het
U2surp	G	A	9: 95,493,711	A143V	probably benign	Het
Vmn2r118	T	A	17: 55,592,714	H730L	possibly damaging	Het
Vmn2r28	G	A	7: 5,481,230	T657I	probably damaging	Het
Ybey	A	T	10: 76,468,199	N56K	probably benign	Het

Other mutations in Cfap46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00493:Cfap46	APN	7	139614443	missense	probably benign	0.06
IGL00505:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00508:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00514:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL01394:Cfap46	APN	7	139666979	missense	probably damaging	1.00
IGL01621:Cfap46	APN	7	139606607	missense	unknown
IGL02171:Cfap46	APN	7	139667056	missense	possibly damaging	0.86
IGL02343:Cfap46	APN	7	139682509	missense	probably damaging	0.99
IGL02679:Cfap46	APN	7	139614470	missense	probably damaging	0.99
IGL02687:Cfap46	APN	7	139607201	missense	probably damaging	0.99
IGL03180:Cfap46	APN	7	139603252	missense	unknown
IGL03329:Cfap46	APN	7	139601165	missense	probably damaging	0.99
FR4449:Cfap46	UTSW	7	139638795	utr 3 prime	probably benign
FR4737:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
FR4976:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
PIT4651001:Cfap46	UTSW	7	139645551	missense
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0318:Cfap46	UTSW	7	139654566	missense	probably damaging	1.00
R0358:Cfap46	UTSW	7	139651533	splice site	probably benign
R0650:Cfap46	UTSW	7	139605655	missense	unknown
R0675:Cfap46	UTSW	7	139676034	missense	probably damaging	1.00
R0750:Cfap46	UTSW	7	139654670	missense	probably damaging	1.00
R0931:Cfap46	UTSW	7	139655841	missense	probably damaging	1.00
R1024:Cfap46	UTSW	7	139642597	missense	probably benign	0.42
R1251:Cfap46	UTSW	7	139601265	missense	probably benign	0.40
R1257:Cfap46	UTSW	7	139654629	nonsense	probably null
R1538:Cfap46	UTSW	7	139683008	missense	probably null	1.00
R1618:Cfap46	UTSW	7	139652810	missense	probably benign	0.04
R1655:Cfap46	UTSW	7	139642520	nonsense	probably null
R1824:Cfap46	UTSW	7	139639602	missense	probably benign	0.12
R1830:Cfap46	UTSW	7	139640407	missense	possibly damaging	0.92
R1857:Cfap46	UTSW	7	139653408	missense	probably damaging	1.00
R1870:Cfap46	UTSW	7	139683470	missense	probably damaging	1.00
R1945:Cfap46	UTSW	7	139679903	missense	probably damaging	1.00
R1962:Cfap46	UTSW	7	139667041	missense	probably damaging	1.00
R2108:Cfap46	UTSW	7	139683761	missense	probably benign	0.03
R2354:Cfap46	UTSW	7	139661046	missense	probably damaging	0.99
R2367:Cfap46	UTSW	7	139653498	missense	probably damaging	0.99
R3237:Cfap46	UTSW	7	139617590	missense	probably damaging	1.00
R3617:Cfap46	UTSW	7	139639599	missense	probably benign	0.06
R3949:Cfap46	UTSW	7	139678551	missense	probably benign	0.12
R4239:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4240:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4297:Cfap46	UTSW	7	139652673	missense	probably benign	0.27
R4365:Cfap46	UTSW	7	139650952	missense	probably damaging	0.99
R4516:Cfap46	UTSW	7	139660082	intron	probably benign
R4595:Cfap46	UTSW	7	139652404	missense	possibly damaging	0.74
R4627:Cfap46	UTSW	7	139657281	missense	probably damaging	0.99
R4627:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4628:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4629:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4687:Cfap46	UTSW	7	139627456	missense	possibly damaging	0.79
R4750:Cfap46	UTSW	7	139679323	critical splice donor site	probably null
R4771:Cfap46	UTSW	7	139630608	missense	probably null
R4779:Cfap46	UTSW	7	139659815	intron	probably benign
R4812:Cfap46	UTSW	7	139636000	missense	probably damaging	1.00
R4974:Cfap46	UTSW	7	139607188	critical splice donor site	probably null
R5014:Cfap46	UTSW	7	139627375	missense	probably benign	0.12
R5033:Cfap46	UTSW	7	139603860	missense	probably benign	0.00
R5055:Cfap46	UTSW	7	139661190	missense	probably damaging	1.00
R5254:Cfap46	UTSW	7	139678514	missense	possibly damaging	0.77
R5288:Cfap46	UTSW	7	139613507	critical splice donor site	probably null
R5366:Cfap46	UTSW	7	139650886	missense	probably damaging	1.00
R5368:Cfap46	UTSW	7	139627473	missense	possibly damaging	0.77
R5371:Cfap46	UTSW	7	139632181	splice site	probably null
R5642:Cfap46	UTSW	7	139678577	missense	probably damaging	1.00
R5690:Cfap46	UTSW	7	139638353	missense	probably benign	0.01
R5691:Cfap46	UTSW	7	139606700	missense	possibly damaging	0.49
R5696:Cfap46	UTSW	7	139612031	missense	probably damaging	1.00
R5844:Cfap46	UTSW	7	139650942	missense	probably damaging	0.99
R5963:Cfap46	UTSW	7	139651595	missense	probably damaging	0.97
R6217:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6228:Cfap46	UTSW	7	139656580	missense	probably damaging	1.00
R6251:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6253:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6285:Cfap46	UTSW	7	139661085	missense	probably damaging	1.00
R6334:Cfap46	UTSW	7	139680831	missense	probably damaging	1.00
R6520:Cfap46	UTSW	7	139614405	critical splice donor site	probably null
R6736:Cfap46	UTSW	7	139619971	missense	possibly damaging	0.92
R6773:Cfap46	UTSW	7	139642561	utr 3 prime	probably benign
R6835:Cfap46	UTSW	7	139652498	missense	probably damaging	0.98
R6903:Cfap46	UTSW	7	139654561	critical splice donor site	probably null
R6912:Cfap46	UTSW	7	139639700	missense	probably benign	0.09
R7163:Cfap46	UTSW	7	139618078	critical splice donor site	probably null
R7232:Cfap46	UTSW	7	139617577	missense	unknown
R7327:Cfap46	UTSW	7	139635146	splice site	probably null
R7336:Cfap46	UTSW	7	139620104	missense	unknown
R7337:Cfap46	UTSW	7	139630576	critical splice donor site	probably null
R7437:Cfap46	UTSW	7	139650837	nonsense	probably null
R7450:Cfap46	UTSW	7	139617437	missense	unknown
R7495:Cfap46	UTSW	7	139603196	critical splice donor site	probably null
R7618:Cfap46	UTSW	7	139603239	missense
R7623:Cfap46	UTSW	7	139618350	missense	unknown
R7765:Cfap46	UTSW	7	139651564	missense
R7971:Cfap46	UTSW	7	139635127	missense	unknown
R8211:Cfap46	UTSW	7	139633304	missense	unknown
R8306:Cfap46	UTSW	7	139656580	missense
R8354:Cfap46	UTSW	7	139653498	missense	probably benign	0.03
R8365:Cfap46	UTSW	7	139683084	nonsense	probably null
R8447:Cfap46	UTSW	7	139680986	missense	possibly damaging	0.90
R8715:Cfap46	UTSW	7	139605644	missense
R8805:Cfap46	UTSW	7	139632063	missense	unknown
R8830:Cfap46	UTSW	7	139615649	missense	unknown
R8912:Cfap46	UTSW	7	139680181	intron	probably benign
R8920:Cfap46	UTSW	7	139652526	missense
R8977:Cfap46	UTSW	7	139679933	missense	probably benign	0.01
R9048:Cfap46	UTSW	7	139627343	missense	unknown
R9224:Cfap46	UTSW	7	139678500	nonsense	probably null
R9252:Cfap46	UTSW	7	139618249	missense	unknown
R9276:Cfap46	UTSW	7	139621291	missense	unknown
R9301:Cfap46	UTSW	7	139642545	missense
R9391:Cfap46	UTSW	7	139618111	missense	unknown
R9402:Cfap46	UTSW	7	139635949	missense	unknown
RF023:Cfap46	UTSW	7	139638918
W0251:Cfap46	UTSW	7	139603946	missense	probably benign	0.11
X0018:Cfap46	UTSW	7	139680912	missense	probably benign	0.03
X0064:Cfap46	UTSW	7	139603447	missense	probably benign	0.01
Z1088:Cfap46	UTSW	7	139635064	missense	probably damaging	0.96
Z1176:Cfap46	UTSW	7	139639548	missense
Z1177:Cfap46	UTSW	7	139601267	missense	unknown
Z1177:Cfap46	UTSW	7	139630626	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGTAGAGAGCAACCTCAGAC -3'
(R):5'- TCAGATATCAGAGCAGCTGTGG -3'

Sequencing Primer
(F):5'- CCTCACTAGGTGGAAATAGTCC -3'
(R):5'- TATCAGAGCAGCTGTGGAGGTAAC -3'

Posted On

2018-08-01