Incidental Mutation 'R6263:Wiz'
ID531210
Institutional Source Beutler Lab
Gene Symbol Wiz
Ensembl Gene ENSMUSG00000024050
Gene Namewidely-interspaced zinc finger motifs
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32354055-32389401 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 32360443 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064694] [ENSMUST00000087703] [ENSMUST00000163107] [ENSMUST00000165912] [ENSMUST00000169488] [ENSMUST00000170617]
Predicted Effect probably benign
Transcript: ENSMUST00000064694
SMART Domains Protein: ENSMUSP00000069443
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 532 554 1.67e-2 SMART
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
ZnF_C2H2 702 724 1.41e0 SMART
low complexity region 784 793 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
ZnF_C2H2 901 927 1.06e2 SMART
low complexity region 936 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087703
SMART Domains Protein: ENSMUSP00000084993
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 531 553 1.67e-2 SMART
low complexity region 575 587 N/A INTRINSIC
low complexity region 606 622 N/A INTRINSIC
ZnF_C2H2 701 723 1.41e0 SMART
low complexity region 783 792 N/A INTRINSIC
low complexity region 868 886 N/A INTRINSIC
ZnF_C2H2 900 926 1.06e2 SMART
low complexity region 935 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163107
SMART Domains Protein: ENSMUSP00000127943
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165912
SMART Domains Protein: ENSMUSP00000127651
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169488
SMART Domains Protein: ENSMUSP00000126253
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
ZnF_C2H2 54 76 4.72e-2 SMART
ZnF_C2H2 227 249 3.52e-1 SMART
low complexity region 294 318 N/A INTRINSIC
ZnF_C2H2 357 379 1.67e-2 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 448 467 N/A INTRINSIC
ZnF_C2H2 541 563 1.67e-2 SMART
low complexity region 585 597 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ZnF_C2H2 711 733 1.41e0 SMART
low complexity region 793 802 N/A INTRINSIC
low complexity region 878 896 N/A INTRINSIC
ZnF_C2H2 910 936 1.06e2 SMART
low complexity region 945 965 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169741
Predicted Effect probably benign
Transcript: ENSMUST00000170617
SMART Domains Protein: ENSMUSP00000130517
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Wiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Wiz APN 17 32356919 missense probably benign 0.43
IGL02176:Wiz APN 17 32356902 missense probably damaging 0.96
IGL02212:Wiz APN 17 32368135 missense probably damaging 1.00
IGL02213:Wiz APN 17 32367860 missense probably benign 0.03
IGL02616:Wiz APN 17 32359469 missense probably damaging 1.00
IGL02654:Wiz APN 17 32359350 missense probably damaging 1.00
IGL02833:Wiz APN 17 32357879 missense probably damaging 1.00
IGL03032:Wiz APN 17 32356558 missense probably benign
E0370:Wiz UTSW 17 32355118 missense probably damaging 1.00
IGL03138:Wiz UTSW 17 32359119 missense probably damaging 1.00
PIT4494001:Wiz UTSW 17 32361931 missense probably damaging 1.00
R0197:Wiz UTSW 17 32356441 missense probably damaging 1.00
R0207:Wiz UTSW 17 32357033 missense probably damaging 1.00
R0701:Wiz UTSW 17 32356441 missense probably damaging 1.00
R0883:Wiz UTSW 17 32356441 missense probably damaging 1.00
R1055:Wiz UTSW 17 32387642 missense probably damaging 0.99
R1968:Wiz UTSW 17 32359372 missense probably damaging 1.00
R2225:Wiz UTSW 17 32356925 missense probably damaging 1.00
R2423:Wiz UTSW 17 32361885 missense probably damaging 1.00
R2860:Wiz UTSW 17 32361706 missense probably damaging 1.00
R2861:Wiz UTSW 17 32361706 missense probably damaging 1.00
R3056:Wiz UTSW 17 32357697 missense probably benign 0.01
R3755:Wiz UTSW 17 32359132 missense probably damaging 1.00
R3885:Wiz UTSW 17 32357038 missense possibly damaging 0.48
R3933:Wiz UTSW 17 32357898 missense probably damaging 1.00
R4038:Wiz UTSW 17 32359224 missense probably damaging 1.00
R4118:Wiz UTSW 17 32369357 utr 3 prime probably benign
R4181:Wiz UTSW 17 32367985 missense probably damaging 1.00
R4651:Wiz UTSW 17 32357681 missense probably damaging 1.00
R4822:Wiz UTSW 17 32356437 nonsense probably null
R4891:Wiz UTSW 17 32357628 missense possibly damaging 0.85
R4923:Wiz UTSW 17 32361596 missense probably benign 0.01
R5014:Wiz UTSW 17 32359366 missense probably damaging 1.00
R5194:Wiz UTSW 17 32377848 utr 3 prime probably benign
R5254:Wiz UTSW 17 32378496 splice site probably benign
R5944:Wiz UTSW 17 32357697 missense probably benign 0.01
R6015:Wiz UTSW 17 32387600 missense probably damaging 0.99
R6571:Wiz UTSW 17 32359324 missense probably damaging 1.00
R6823:Wiz UTSW 17 32360421 missense probably damaging 0.99
R7014:Wiz UTSW 17 32361866 missense probably damaging 0.98
R7051:Wiz UTSW 17 32361533 missense probably damaging 1.00
R7144:Wiz UTSW 17 32357628 missense possibly damaging 0.85
R7221:Wiz UTSW 17 32359165 missense probably benign 0.03
R7260:Wiz UTSW 17 32359111 missense probably damaging 0.99
R7453:Wiz UTSW 17 32379075 missense probably benign 0.00
R7849:Wiz UTSW 17 32357786 missense probably benign 0.26
R8686:Wiz UTSW 17 32367847 missense probably damaging 1.00
U24488:Wiz UTSW 17 32387675 missense probably damaging 1.00
X0026:Wiz UTSW 17 32387758 start codon destroyed probably null 0.94
Z1176:Wiz UTSW 17 32361495 missense probably damaging 1.00
Z1177:Wiz UTSW 17 32357778 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATCAGAGGCCCAGAAAATGC -3'
(R):5'- TAGGCAGGGAATAGGCTACC -3'

Sequencing Primer
(F):5'- ATACCCGAGGCCTTCAGCTTG -3'
(R):5'- CAGGGAATAGGCTACCTGAAATCTAC -3'
Posted On2018-08-02