Incidental Mutation 'R6324:Lin7a'
ID531211
Institutional Source Beutler Lab
Gene Symbol Lin7a
Ensembl Gene ENSMUSG00000019906
Gene Namelin-7 homolog A (C. elegans)
SynonymsVeli, LIN-7A, TIP-33, MALS-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location107271686-107421474 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 107380215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020057] [ENSMUST00000105280] [ENSMUST00000218031]
Predicted Effect probably benign
Transcript: ENSMUST00000020057
SMART Domains Protein: ENSMUSP00000020057
Gene: ENSMUSG00000019906

DomainStartEndE-ValueType
L27 28 83 2.59e-12 SMART
low complexity region 84 99 N/A INTRINSIC
PDZ 116 190 1.32e-23 SMART
low complexity region 210 229 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105280
SMART Domains Protein: ENSMUSP00000100916
Gene: ENSMUSG00000019906

DomainStartEndE-ValueType
PDZ 1 68 8.27e-16 SMART
coiled coil region 69 93 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218031
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in generating and maintaining the asymmetric distribution of channels and receptors at the cell membrane. The encoded protein also is required for the localization of some specific channels and can be part of a protein complex that couples synaptic vesicle exocytosis to cell adhesion in the brain. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prl7b1 A T 13: 27,602,895 probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Lin7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Lin7a APN 10 107412025 missense possibly damaging 0.94
R1226:Lin7a UTSW 10 107271919 missense probably benign
R1386:Lin7a UTSW 10 107412122 missense unknown
R1449:Lin7a UTSW 10 107323952 missense probably damaging 0.99
R1543:Lin7a UTSW 10 107412069 missense possibly damaging 0.46
R1845:Lin7a UTSW 10 107412059 missense probably damaging 1.00
R4599:Lin7a UTSW 10 107412166 missense unknown
R5001:Lin7a UTSW 10 107382669 nonsense probably null
R6700:Lin7a UTSW 10 107380306 splice site probably null
R7023:Lin7a UTSW 10 107382628 missense possibly damaging 0.65
R7670:Lin7a UTSW 10 107382691 missense possibly damaging 0.91
R7902:Lin7a UTSW 10 107323982 missense possibly damaging 0.88
R8355:Lin7a UTSW 10 107382636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATCTGTACTGGAAGAATTGATG -3'
(R):5'- GATTTGCTTGTGCCAAATGGAC -3'

Sequencing Primer
(F):5'- TACTGTTAATGGCTGCCC -3'
(R):5'- GCTTGTGCCAAATGGACATTTAG -3'
Posted On2018-08-02