Mutagenetix > Incidental Mutations

Incidental Mutation 'R6324:Lin7a'

531211

Institutional Source

Beutler Lab

Gene Symbol

Lin7a

Ensembl Gene

ENSMUSG00000019906

Gene Name

lin-7 homolog A (C. elegans)

Synonyms

Veli, LIN-7A, TIP-33, MALS-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6324 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107271686-107421474 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 107380215 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020057] [ENSMUST00000105280] [ENSMUST00000218031]

Predicted Effect

probably benign
Transcript: ENSMUST00000020057

SMART Domains

Protein: ENSMUSP00000020057
Gene: ENSMUSG00000019906

Domain	Start	End	E-Value	Type
L27	28	83	2.59e-12	SMART
low complexity region	84	99	N/A	INTRINSIC
PDZ	116	190	1.32e-23	SMART
low complexity region	210	229	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105280

SMART Domains

Protein: ENSMUSP00000100916
Gene: ENSMUSG00000019906

Domain	Start	End	E-Value	Type
PDZ	1	68	8.27e-16	SMART
coiled coil region	69	93	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000218031

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in generating and maintaining the asymmetric distribution of channels and receptors at the cell membrane. The encoded protein also is required for the localization of some specific channels and can be part of a protein complex that couples synaptic vesicle exocytosis to cell adhesion in the brain. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025F22Rik	T	A	19: 11,163,447	M3L	probably benign	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Atp13a3	A	G	16: 30,332,285	V1069A	possibly damaging	Het
Atp1a2	C	G	1: 172,289,336	R238P	probably damaging	Het
Baz2b	A	G	2: 59,906,948	S1877P	probably damaging	Het
Ccdc114	A	G	7: 45,941,710	E203G	probably damaging	Het
Ccdc27	A	T	4: 154,036,191	S383T	probably benign	Het
Cr1l	A	G	1: 195,111,122	V377A	probably benign	Het
Dazap1	A	G	10: 80,277,660	E130G	probably benign	Het
Dchs1	G	T	7: 105,764,938	A890E	probably benign	Het
Dock10	G	A	1: 80,505,176	T2143I	probably benign	Het
Eif3j1	A	G	2: 122,041,178	D60G	probably benign	Het
Enah	A	G	1: 181,918,571	S382P	probably damaging	Het
Fam171b	A	T	2: 83,879,264	K427*	probably null	Het
Fmn2	A	T	1: 174,612,553	I1179L	possibly damaging	Het
Focad	C	T	4: 88,401,068	R1505*	probably null	Het
Frem1	T	C	4: 82,983,337	T985A	probably benign	Het
Gm3404	A	T	5: 146,528,107	Q219L	possibly damaging	Het
Gm5592	A	C	7: 41,286,535	S154R	probably damaging	Het
Gpn3	C	T	5: 122,372,575		probably benign	Het
Gpr158	A	G	2: 21,810,554	E586G	probably damaging	Het
Gstp2	A	T	19: 4,040,499	I162N	probably benign	Het
Loxl4	G	A	19: 42,595,378	L745F	probably benign	Het
Mybpc1	A	G	10: 88,568,619	I172T	possibly damaging	Het
Nalcn	A	G	14: 123,409,749	W571R	possibly damaging	Het
Nkx2-5	G	C	17: 26,841,121	P79A	probably benign	Het
Nufip2	A	G	11: 77,691,661	T134A	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1342	G	A	4: 118,690,531		probably benign	Het
Olfr1463	A	G	19: 13,235,104	M285V	possibly damaging	Het
Phkb	A	G	8: 86,018,542	D616G	probably benign	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Prl7b1	A	T	13: 27,602,895		probably null	Het
Prop1	G	A	11: 50,952,199	P54S	probably benign	Het
Ptcd3	C	T	6: 71,885,327	V509I	probably benign	Het
Ptprg	T	A	14: 12,226,314	D527E	probably damaging	Het
Rapgef2	C	T	3: 79,079,132	V1182I	probably benign	Het
Rfx7	C	A	9: 72,618,414	P962Q	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc38a9	A	G	13: 112,726,100	I444M	probably benign	Het
Sorbs1	T	C	19: 40,321,819	T492A	probably damaging	Het
Synj1	A	T	16: 90,938,630	S1478R	probably benign	Het
Tnn	T	A	1: 160,145,204	N276I	probably damaging	Het
Trbv19	G	A	6: 41,178,758	G21D	probably damaging	Het
Ube2o	A	T	11: 116,539,359	D1184E	probably benign	Het
Vmn1r181	G	A	7: 23,984,758	R216Q	probably benign	Het
Vmn2r108	A	T	17: 20,471,715	L182*	probably null	Het
Vmn2r15	A	G	5: 109,286,271	*856R	probably null	Het
Vmn2r70	G	A	7: 85,558,879	H797Y	probably benign	Het
Zfp11	C	T	5: 129,656,523	A625T	possibly damaging	Het

Other mutations in Lin7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01951:Lin7a	APN	10	107412025	missense	possibly damaging	0.94
R1226:Lin7a	UTSW	10	107271919	missense	probably benign
R1386:Lin7a	UTSW	10	107412122	missense	unknown
R1449:Lin7a	UTSW	10	107323952	missense	probably damaging	0.99
R1543:Lin7a	UTSW	10	107412069	missense	possibly damaging	0.46
R1845:Lin7a	UTSW	10	107412059	missense	probably damaging	1.00
R4599:Lin7a	UTSW	10	107412166	missense	unknown
R5001:Lin7a	UTSW	10	107382669	nonsense	probably null
R6700:Lin7a	UTSW	10	107380306	splice site	probably null
R7023:Lin7a	UTSW	10	107382628	missense	possibly damaging	0.65
R7670:Lin7a	UTSW	10	107382691	missense	possibly damaging	0.91
R7902:Lin7a	UTSW	10	107323982	missense	possibly damaging	0.88
R8355:Lin7a	UTSW	10	107382636	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTATCTGTACTGGAAGAATTGATG -3'
(R):5'- GATTTGCTTGTGCCAAATGGAC -3'

Sequencing Primer
(F):5'- TACTGTTAATGGCTGCCC -3'
(R):5'- GCTTGTGCCAAATGGACATTTAG -3'

Posted On

2018-08-02