Incidental Mutation 'R6324:Prl7b1'
ID531212
Institutional Source Beutler Lab
Gene Symbol Prl7b1
Ensembl Gene ENSMUSG00000021347
Gene Nameprolactin family 7, subfamily b, member 1
SynonymsPLP-N, Prlpn, 1600014J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6324 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location27601819-27610582 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 27602895 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080595]
Predicted Effect probably null
Transcript: ENSMUST00000080595
SMART Domains Protein: ENSMUSP00000079431
Gene: ENSMUSG00000021347

DomainStartEndE-ValueType
Pfam:Hormone_1 16 241 3.1e-60 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced fetal growth and survival following exposure of dams to low oxygen conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,163,447 M3L probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp13a3 A G 16: 30,332,285 V1069A possibly damaging Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2b A G 2: 59,906,948 S1877P probably damaging Het
Ccdc114 A G 7: 45,941,710 E203G probably damaging Het
Ccdc27 A T 4: 154,036,191 S383T probably benign Het
Cr1l A G 1: 195,111,122 V377A probably benign Het
Dazap1 A G 10: 80,277,660 E130G probably benign Het
Dchs1 G T 7: 105,764,938 A890E probably benign Het
Dock10 G A 1: 80,505,176 T2143I probably benign Het
Eif3j1 A G 2: 122,041,178 D60G probably benign Het
Enah A G 1: 181,918,571 S382P probably damaging Het
Fam171b A T 2: 83,879,264 K427* probably null Het
Fmn2 A T 1: 174,612,553 I1179L possibly damaging Het
Focad C T 4: 88,401,068 R1505* probably null Het
Frem1 T C 4: 82,983,337 T985A probably benign Het
Gm3404 A T 5: 146,528,107 Q219L possibly damaging Het
Gm5592 A C 7: 41,286,535 S154R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gpr158 A G 2: 21,810,554 E586G probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Lin7a T A 10: 107,380,215 probably null Het
Loxl4 G A 19: 42,595,378 L745F probably benign Het
Mybpc1 A G 10: 88,568,619 I172T possibly damaging Het
Nalcn A G 14: 123,409,749 W571R possibly damaging Het
Nkx2-5 G C 17: 26,841,121 P79A probably benign Het
Nufip2 A G 11: 77,691,661 T134A probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1342 G A 4: 118,690,531 probably benign Het
Olfr1463 A G 19: 13,235,104 M285V possibly damaging Het
Phkb A G 8: 86,018,542 D616G probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prop1 G A 11: 50,952,199 P54S probably benign Het
Ptcd3 C T 6: 71,885,327 V509I probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rapgef2 C T 3: 79,079,132 V1182I probably benign Het
Rfx7 C A 9: 72,618,414 P962Q probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc38a9 A G 13: 112,726,100 I444M probably benign Het
Sorbs1 T C 19: 40,321,819 T492A probably damaging Het
Synj1 A T 16: 90,938,630 S1478R probably benign Het
Tnn T A 1: 160,145,204 N276I probably damaging Het
Trbv19 G A 6: 41,178,758 G21D probably damaging Het
Ube2o A T 11: 116,539,359 D1184E probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r108 A T 17: 20,471,715 L182* probably null Het
Vmn2r15 A G 5: 109,286,271 *856R probably null Het
Vmn2r70 G A 7: 85,558,879 H797Y probably benign Het
Zfp11 C T 5: 129,656,523 A625T possibly damaging Het
Other mutations in Prl7b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Prl7b1 APN 13 27604590 missense probably damaging 0.98
IGL01350:Prl7b1 APN 13 27602821 missense probably damaging 1.00
IGL01602:Prl7b1 APN 13 27602044 missense possibly damaging 0.70
IGL01605:Prl7b1 APN 13 27602044 missense possibly damaging 0.70
IGL03106:Prl7b1 APN 13 27606935 missense probably benign 0.17
IGL03401:Prl7b1 APN 13 27601981 missense probably benign 0.02
fleshy UTSW 13 27602895 splice site probably null
R1169:Prl7b1 UTSW 13 27606904 missense possibly damaging 0.81
R1423:Prl7b1 UTSW 13 27602127 missense probably damaging 0.99
R1846:Prl7b1 UTSW 13 27602848 missense probably damaging 1.00
R2294:Prl7b1 UTSW 13 27602871 missense possibly damaging 0.93
R6049:Prl7b1 UTSW 13 27606178 missense probably benign 0.03
R6065:Prl7b1 UTSW 13 27604546 missense probably benign 0.01
R6870:Prl7b1 UTSW 13 27604533 missense probably damaging 1.00
R7473:Prl7b1 UTSW 13 27602013 missense possibly damaging 0.70
R7742:Prl7b1 UTSW 13 27607048 missense probably benign 0.07
R8301:Prl7b1 UTSW 13 27602772 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGGCAATCTTCATGATGCGATC -3'
(R):5'- AAGCAACATGGTGGTTCATTAG -3'

Sequencing Primer
(F):5'- TCTTCATGATGCGATCCAGAAGG -3'
(R):5'- CAACATGGTGGTTCATTAGAAAAAG -3'
Posted On2018-08-02