Incidental Mutation 'R6371:Cntln'
List |< first << previous [record 12 of 50] next >> last >|
ID531218
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Namecentlein, centrosomal protein
SynonymsB430108F07Rik, D530005L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R6371 (G1)
Quality Score46.0072
Status Validated
Chromosome4
Chromosomal Location84884309-85131921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84884579 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 39 (S39P)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: S39P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: S39P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102819
AA Change: S39P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070
AA Change: S39P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
coiled coil region 166 277 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: S39P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: S39P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
R7670:Cntln UTSW 4 84979340 missense possibly damaging 0.66
R7707:Cntln UTSW 4 84884616 missense probably damaging 1.00
R7895:Cntln UTSW 4 85063324 missense possibly damaging 0.91
R8176:Cntln UTSW 4 84888689 missense probably damaging 0.99
R8247:Cntln UTSW 4 85100780 missense probably benign 0.39
R8264:Cntln UTSW 4 85098411 missense probably damaging 1.00
R8293:Cntln UTSW 4 85033838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCAGGCACTTCGGACTC -3'
(R):5'- CCAGTCCTGATACCTGACACAG -3'

Sequencing Primer
(F):5'- CAATGAACTTGCTGGTCGAG -3'
(R):5'- AGGGCCAGCTCCTCCTTTAG -3'
Posted On2018-08-06