Incidental Mutation 'R6371:Ppia'
List |< first << previous [record 36 of 50] next >> last >|
ID531219
Institutional Source Beutler Lab
Gene Symbol Ppia
Ensembl Gene ENSMUSG00000071866
Gene Namepeptidylprolyl isomerase A
SynonymsCphn, CyP-18, CypA, cyclophilin A
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R6371 (G1)
Quality Score63.0073
Status Validated
Chromosome11
Chromosomal Location6415443-6419817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6418230 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 37 (T37I)
Ref Sequence ENSEMBL: ENSMUSP00000149662 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000090749
AA Change: T37I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. The encoded protein is a cyclosporin binding-protein and may play a role in cyclosporin A-mediated immunosuppression. The protein can also interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions. Multiple pseudogenes that map to different chromosomes have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene tend to develop blepharitis (about 30% of mice) as well as inflammation in other organs. Some background dependent embryonic lethality occurs but adults are robust and live normal life spans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Ppia
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7394:Ppia UTSW 11 6419218 missense possibly damaging 0.77
R7749:Ppia UTSW 11 6419569 missense probably benign 0.01
Z1176:Ppia UTSW 11 6419600 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGACATTAAGCATGAGACTGTTCAC -3'
(R):5'- CATGCTGGCTCAATAAAAGGAG -3'

Sequencing Primer
(F):5'- GTTCCAAAGACAGCAGGT -3'
(R):5'- GGTCCTGAGTTCAAATCCCAG -3'
Posted On2018-08-06