Mutagenetix > Incidental Mutations

Incidental Mutation 'R6283:Knl1'

531225

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

2310043D08Rik, 5730505K17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119047119-119105501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119070286 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 823 (T823A)

Ref Sequence

ENSEMBL: ENSMUSP00000097140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028799
AA Change: T823A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: T823A

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000028802
AA Change: T823A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: T823A

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000099542
AA Change: T823A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: T823A

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	G	A	9: 103,282,635	R14*	probably null	Het
Acsf3	C	A	8: 122,785,955	R372S	probably damaging	Het
Adamts20	A	G	15: 94,351,721	S472P	probably benign	Het
Bhlhe40	T	C	6: 108,665,031	L312P	probably damaging	Het
Ccdc180	A	G	4: 45,902,486	E305G	possibly damaging	Het
Ccdc83	T	A	7: 90,236,407	R257*	probably null	Het
Cd209e	G	A	8: 3,849,212	Q167*	probably null	Het
Cd300e	G	A	11: 115,054,554	T138I	probably benign	Het
Ces2c	A	T	8: 104,849,699	M115L	probably benign	Het
Cfap61	T	A	2: 146,129,102		probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	T	7: 25,286,034	S301L	probably damaging	Het
Cks2	A	G	13: 51,645,459	H16R	probably benign	Het
Copa	A	T	1: 172,118,848	H953L	possibly damaging	Het
Ctdsp2	T	C	10: 126,995,880	V145A	possibly damaging	Het
Cyp2j13	A	G	4: 96,056,837	V377A	possibly damaging	Het
Dhx57	A	G	17: 80,274,805	V404A	probably benign	Het
Dock2	T	C	11: 34,707,325	S340G	probably damaging	Het
Ggps1	A	G	13: 14,057,794		probably null	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm11444	T	C	11: 85,846,791		probably null	Het
Gm853	A	G	4: 130,221,741	S5P	probably benign	Het
Grina	A	G	15: 76,248,551	T173A	possibly damaging	Het
Hcrtr1	G	A	4: 130,135,340	T223I	probably benign	Het
Igsf10	T	A	3: 59,319,449	T2268S	probably damaging	Het
Ino80d	C	T	1: 63,062,126	R447Q	probably damaging	Het
Inpp4b	C	T	8: 81,770,833	T94M	probably damaging	Het
Itga2	A	G	13: 114,869,250	Y465H	probably damaging	Het
Krtap4-16	A	G	11: 99,851,035	S180P	unknown	Het
Lpar6	A	T	14: 73,238,857	D86V	probably damaging	Het
Muc5ac	C	A	7: 141,816,864	C2500*	probably null	Het
Mzf1	T	C	7: 13,053,369		probably benign	Het
Olfr1032	G	T	2: 86,008,099	V108L	possibly damaging	Het
Olfr1176	T	A	2: 88,339,658	I31N	probably benign	Het
Olfr1311	A	C	2: 112,021,260	M198R	possibly damaging	Het
Olfr1352	T	C	10: 78,984,279	V163A	probably benign	Het
Otogl	T	G	10: 107,790,500	E1501A	probably damaging	Het
Pcdh10	T	A	3: 45,381,554	S768T	possibly damaging	Het
Pcnx2	G	T	8: 125,877,586	Q644K	probably damaging	Het
Pdzd9	T	A	7: 120,660,226	I180F	possibly damaging	Het
Pinx1	A	C	14: 63,878,172	N152T	probably benign	Het
Prr14l	T	C	5: 32,830,264	E629G	probably benign	Het
Qpctl	T	A	7: 19,148,420	I104F	probably benign	Het
Rabep1	C	T	11: 70,917,679	A444V	probably damaging	Het
Rnf150	A	G	8: 82,990,554	Y230C	probably damaging	Het
Slc25a27	A	C	17: 43,657,730	V152G	probably damaging	Het
Swt1	A	G	1: 151,384,333	S772P	possibly damaging	Het
Tenm4	A	G	7: 96,874,494	T1711A	probably benign	Het
Tfap2d	G	C	1: 19,104,478	G52R	probably benign	Het
Tmem265	T	G	7: 127,564,872	V86G	possibly damaging	Het
Trpm8	C	T	1: 88,348,332	H551Y	probably benign	Het
Ttc6	T	G	12: 57,702,262	Y1327D	possibly damaging	Het
Uevld	G	T	7: 46,937,981	Q324K	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r73	C	T	7: 85,871,841	M306I	probably benign	Het
Vmn2r93	T	A	17: 18,304,104	M120K	probably benign	Het
Zfp804b	T	A	5: 6,769,908	I1016F	probably benign	Het
Zfp90	T	C	8: 106,425,394	C580R	probably damaging	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	119064083	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	119102499	missense	probably benign	0.19
IGL00666:Knl1	APN	2	119070464	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	119076980	missense	probably benign	0.33
IGL01395:Knl1	APN	2	119071566	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	119070001	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	119104061	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	119100774	missense	probably benign	0.40
IGL02105:Knl1	APN	2	119071808	missense	probably benign
IGL02106:Knl1	APN	2	119072008	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	119069152	missense	probably benign	0.01
IGL02252:Knl1	APN	2	119072540	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	119070323	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	119070992	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	119077969	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	119070930	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	119088831	missense	probably benign	0.08
IGL03100:Knl1	APN	2	119100770	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	119070617	missense	probably benign	0.02
IGL03138:Knl1	UTSW	2	119072359	missense	probably damaging	0.96
R0023:Knl1	UTSW	2	119102549	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0078:Knl1	UTSW	2	119069892	missense	probably benign	0.16
R0178:Knl1	UTSW	2	119058405	splice site	probably benign
R0295:Knl1	UTSW	2	119088839	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	119104061	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	119068388	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	119097435	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	119088901	splice site	probably benign
R0920:Knl1	UTSW	2	119069828	missense	probably benign	0.00
R1120:Knl1	UTSW	2	119062375	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	119071154	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	119071189	missense	probably benign	0.00
R1241:Knl1	UTSW	2	119072573	missense	probably benign	0.03
R1387:Knl1	UTSW	2	119070730	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	119068307	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	119071738	missense	probably benign	0.01
R1721:Knl1	UTSW	2	119076334	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	119071819	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	119087594	critical splice donor site	probably null
R2227:Knl1	UTSW	2	119072000	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	119072227	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	119072281	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	119058368	nonsense	probably null
R3115:Knl1	UTSW	2	119070391	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	119068944	missense	probably benign	0.32
R3431:Knl1	UTSW	2	119062362	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	119102579	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	119059599	missense	probably benign	0.00
R4600:Knl1	UTSW	2	119070544	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	119069137	nonsense	probably null
R4758:Knl1	UTSW	2	119071732	frame shift	probably null
R4762:Knl1	UTSW	2	119071936	missense	probably benign	0.01
R4869:Knl1	UTSW	2	119072351	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	119081513	missense	probably benign	0.22
R4935:Knl1	UTSW	2	119068957	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	119070031	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	119069176	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	119069695	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	119070255	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	119070983	missense	probably benign	0.01
R5493:Knl1	UTSW	2	119068730	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	119070352	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	119081550	nonsense	probably null
R5854:Knl1	UTSW	2	119070403	missense	probably benign	0.02
R5979:Knl1	UTSW	2	119069360	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	119094068	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	119071941	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	119069318	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	119069003	missense	probably benign	0.02
R6608:Knl1	UTSW	2	119086612	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	119095184	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	119070785	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	119069299	missense	probably benign	0.35
R7270:Knl1	UTSW	2	119102522	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	119071686	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	119070559	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	119095226	nonsense	probably null
R7408:Knl1	UTSW	2	119070592	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	119087546	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	119070698	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	119065979	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	119094006	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	119095133	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	119071556	missense	probably benign	0.13
R7847:Knl1	UTSW	2	119070976	missense	probably benign	0.02
R7930:Knl1	UTSW	2	119070976	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACCATTTTGCATGCACGTG -3'
(R):5'- CAGGCTTTTGTGCATCATTAGTTTC -3'

Sequencing Primer
(F):5'- TGCATGCACGTGGTCAG -3'
(R):5'- CTAATATTGTTAGCTGGCTGCC -3'

Posted On

2018-08-07