Incidental Mutation 'R6313:Knl1'
ID 531228
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Name kinetochore scaffold 1
Synonyms Casc5, 2310043D08Rik, 5730505K17Rik
MMRRC Submission 044470-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6313 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 118877600-118935982 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118899799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 500 (L500H)
Ref Sequence ENSEMBL: ENSMUSP00000028799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542]
AlphaFold Q66JQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000028799
AA Change: L500H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: L500H

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028802
AA Change: L500H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: L500H

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000099542
AA Change: L500H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: L500H

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,126,344 (GRCm39) F1167L probably damaging Het
Abraxas2 G A 7: 132,476,694 (GRCm39) A145T probably damaging Het
Acaca C T 11: 84,183,755 (GRCm39) T32I probably benign Het
Adam6a A T 12: 113,508,670 (GRCm39) N348Y possibly damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arhgef38 T C 3: 132,940,469 (GRCm39) D39G possibly damaging Het
Arid5b T C 10: 67,933,412 (GRCm39) D587G possibly damaging Het
Brwd1 A G 16: 95,809,141 (GRCm39) V1963A probably benign Het
Ccdc136 T A 6: 29,410,204 (GRCm39) L34Q probably damaging Het
Cdh2 T C 18: 16,907,579 (GRCm39) Q53R probably benign Het
Celsr2 G A 3: 108,308,530 (GRCm39) S1799L probably damaging Het
Cenpe A G 3: 134,935,936 (GRCm39) E457G probably benign Het
Cmtm1 A T 8: 105,031,795 (GRCm39) M283K possibly damaging Het
Dcdc5 T C 2: 106,198,516 (GRCm39) noncoding transcript Het
Decr1 T A 4: 15,924,261 (GRCm39) M220L probably benign Het
Dgkg T G 16: 22,338,311 (GRCm39) D592A probably damaging Het
Dkkl1 T C 7: 44,860,862 (GRCm39) Q39R probably benign Het
Dyrk1a T A 16: 94,460,373 (GRCm39) C10S possibly damaging Het
Efcab2 A T 1: 178,308,936 (GRCm39) E146D probably benign Het
Efhc1 T C 1: 21,049,652 (GRCm39) V504A possibly damaging Het
Ermard T G 17: 15,273,467 (GRCm39) probably null Het
Espl1 T C 15: 102,224,247 (GRCm39) V1266A probably benign Het
Fbxw22 A C 9: 109,232,465 (GRCm39) V40G probably damaging Het
Gm3629 A T 14: 17,834,409 (GRCm39) I194N possibly damaging Het
Gnai2 C T 9: 107,497,296 (GRCm39) V33M possibly damaging Het
H2-DMb1 T C 17: 34,376,506 (GRCm39) probably null Het
Hc T C 2: 34,879,851 (GRCm39) probably null Het
Iars1 T C 13: 49,861,921 (GRCm39) S491P probably damaging Het
Lamb1 A T 12: 31,319,146 (GRCm39) T102S probably damaging Het
Lrrc7 A G 3: 157,866,373 (GRCm39) S1123P probably damaging Het
Mettl5 C A 2: 69,702,071 (GRCm39) probably null Het
Mmp11 A G 10: 75,759,818 (GRCm39) *4R probably null Het
Myom1 A T 17: 71,389,483 (GRCm39) D911V probably benign Het
Nid1 A G 13: 13,638,367 (GRCm39) T96A probably benign Het
Nlrp4e G T 7: 23,052,597 (GRCm39) V839L probably benign Het
Notch3 A T 17: 32,370,128 (GRCm39) probably null Het
Or8k35 T C 2: 86,424,411 (GRCm39) T254A possibly damaging Het
Pcdh8 T C 14: 80,005,091 (GRCm39) H978R probably benign Het
Pde8b A T 13: 95,178,508 (GRCm39) C537* probably null Het
Polr1b T C 2: 128,967,366 (GRCm39) F920L probably damaging Het
Polr2f A G 15: 79,035,573 (GRCm39) T87A probably damaging Het
Pon2 T A 6: 5,272,421 (GRCm39) H133L probably damaging Het
Pou2af2 C T 9: 51,201,481 (GRCm39) D192N probably damaging Het
Ptk2b T A 14: 66,416,280 (GRCm39) E205V probably damaging Het
Rb1cc1 T A 1: 6,314,357 (GRCm39) M343K probably benign Het
Rlf G A 4: 121,005,807 (GRCm39) R1058W probably damaging Het
S100z T A 13: 95,615,082 (GRCm39) K28* probably null Het
Scarf1 T A 11: 75,411,141 (GRCm39) N273K probably benign Het
Setd2 A G 9: 110,385,434 (GRCm39) I136M unknown Het
Sfrp2 A G 3: 83,674,291 (GRCm39) D148G probably benign Het
Slc24a4 A G 12: 102,220,769 (GRCm39) E400G probably benign Het
Slc2a9 T G 5: 38,610,464 (GRCm39) I112L probably benign Het
Smc5 A T 19: 23,186,312 (GRCm39) Y972* probably null Het
Sntg1 T C 1: 8,515,248 (GRCm39) probably null Het
Spata31h1 T C 10: 82,129,470 (GRCm39) N1180S probably benign Het
Stag1 A G 9: 100,639,786 (GRCm39) D114G probably damaging Het
Suclg1 T C 6: 73,233,192 (GRCm39) S46P probably damaging Het
Synj1 C T 16: 90,743,703 (GRCm39) A1186T probably benign Het
Tas2r124 A G 6: 132,732,410 (GRCm39) T240A probably benign Het
Tax1bp1 T C 6: 52,721,341 (GRCm39) probably null Het
Tchh C A 3: 93,355,158 (GRCm39) Q1533K unknown Het
Tmprss15 T C 16: 78,759,058 (GRCm39) T887A probably benign Het
Ttn T C 2: 76,536,937 (GRCm39) I34963V probably benign Het
Unc79 G A 12: 103,078,878 (GRCm39) G1485D probably damaging Het
Usp9y G T Y: 1,385,355 (GRCm39) H633N probably benign Homo
Vmn2r99 A T 17: 19,602,867 (GRCm39) N541Y probably damaging Het
Zbtb11 T A 16: 55,810,854 (GRCm39) N337K probably benign Het
Zfp260 T A 7: 29,804,267 (GRCm39) C56S possibly damaging Het
Zfp457 C T 13: 67,440,746 (GRCm39) E610K probably damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 118,894,564 (GRCm39) missense probably damaging 0.96
IGL00582:Knl1 APN 2 118,932,980 (GRCm39) missense probably benign 0.19
IGL00666:Knl1 APN 2 118,900,945 (GRCm39) missense probably damaging 0.96
IGL01062:Knl1 APN 2 118,907,461 (GRCm39) missense probably benign 0.33
IGL01395:Knl1 APN 2 118,902,047 (GRCm39) missense probably damaging 0.96
IGL01604:Knl1 APN 2 118,900,482 (GRCm39) missense probably damaging 1.00
IGL01996:Knl1 APN 2 118,934,542 (GRCm39) missense probably damaging 1.00
IGL02086:Knl1 APN 2 118,931,255 (GRCm39) missense probably benign 0.40
IGL02105:Knl1 APN 2 118,902,289 (GRCm39) missense probably benign
IGL02106:Knl1 APN 2 118,902,489 (GRCm39) missense possibly damaging 0.89
IGL02201:Knl1 APN 2 118,899,633 (GRCm39) missense probably benign 0.01
IGL02252:Knl1 APN 2 118,903,021 (GRCm39) missense probably damaging 1.00
IGL02414:Knl1 APN 2 118,900,804 (GRCm39) missense possibly damaging 0.83
IGL02655:Knl1 APN 2 118,901,473 (GRCm39) missense possibly damaging 0.62
IGL02682:Knl1 APN 2 118,908,450 (GRCm39) missense possibly damaging 0.86
IGL02710:Knl1 APN 2 118,901,411 (GRCm39) missense probably damaging 0.99
IGL02877:Knl1 APN 2 118,919,312 (GRCm39) missense probably benign 0.08
IGL03100:Knl1 APN 2 118,931,251 (GRCm39) missense probably damaging 0.99
IGL03210:Knl1 APN 2 118,901,098 (GRCm39) missense probably benign 0.02
IGL03138:Knl1 UTSW 2 118,902,840 (GRCm39) missense probably damaging 0.96
R0023:Knl1 UTSW 2 118,933,030 (GRCm39) missense possibly damaging 0.73
R0064:Knl1 UTSW 2 118,906,724 (GRCm39) missense probably benign 0.00
R0064:Knl1 UTSW 2 118,906,724 (GRCm39) missense probably benign 0.00
R0078:Knl1 UTSW 2 118,900,373 (GRCm39) missense probably benign 0.16
R0178:Knl1 UTSW 2 118,888,886 (GRCm39) splice site probably benign
R0295:Knl1 UTSW 2 118,919,320 (GRCm39) missense probably damaging 1.00
R0433:Knl1 UTSW 2 118,934,542 (GRCm39) missense probably damaging 0.96
R0453:Knl1 UTSW 2 118,898,869 (GRCm39) missense probably damaging 1.00
R0569:Knl1 UTSW 2 118,927,916 (GRCm39) missense possibly damaging 0.95
R0827:Knl1 UTSW 2 118,919,382 (GRCm39) splice site probably benign
R0920:Knl1 UTSW 2 118,900,309 (GRCm39) missense probably benign 0.00
R1120:Knl1 UTSW 2 118,892,856 (GRCm39) missense probably damaging 0.99
R1155:Knl1 UTSW 2 118,901,635 (GRCm39) missense possibly damaging 0.90
R1204:Knl1 UTSW 2 118,901,670 (GRCm39) missense probably benign 0.00
R1241:Knl1 UTSW 2 118,903,054 (GRCm39) missense probably benign 0.03
R1387:Knl1 UTSW 2 118,901,211 (GRCm39) missense possibly damaging 0.93
R1448:Knl1 UTSW 2 118,898,788 (GRCm39) missense probably damaging 1.00
R1469:Knl1 UTSW 2 118,901,827 (GRCm39) missense possibly damaging 0.73
R1469:Knl1 UTSW 2 118,901,827 (GRCm39) missense possibly damaging 0.73
R1719:Knl1 UTSW 2 118,902,219 (GRCm39) missense probably benign 0.01
R1721:Knl1 UTSW 2 118,906,815 (GRCm39) missense probably damaging 1.00
R2128:Knl1 UTSW 2 118,902,300 (GRCm39) missense possibly damaging 0.79
R2170:Knl1 UTSW 2 118,918,075 (GRCm39) critical splice donor site probably null
R2227:Knl1 UTSW 2 118,902,481 (GRCm39) missense probably damaging 0.97
R2246:Knl1 UTSW 2 118,902,708 (GRCm39) missense probably damaging 1.00
R2275:Knl1 UTSW 2 118,902,762 (GRCm39) missense probably damaging 0.99
R2508:Knl1 UTSW 2 118,888,849 (GRCm39) nonsense probably null
R3115:Knl1 UTSW 2 118,900,872 (GRCm39) missense possibly damaging 0.53
R3122:Knl1 UTSW 2 118,899,425 (GRCm39) missense probably benign 0.32
R3431:Knl1 UTSW 2 118,892,843 (GRCm39) missense probably damaging 1.00
R3755:Knl1 UTSW 2 118,933,060 (GRCm39) missense probably damaging 1.00
R4461:Knl1 UTSW 2 118,890,080 (GRCm39) missense probably benign 0.00
R4600:Knl1 UTSW 2 118,901,025 (GRCm39) missense possibly damaging 0.90
R4713:Knl1 UTSW 2 118,899,618 (GRCm39) nonsense probably null
R4758:Knl1 UTSW 2 118,902,213 (GRCm39) frame shift probably null
R4762:Knl1 UTSW 2 118,902,417 (GRCm39) missense probably benign 0.01
R4869:Knl1 UTSW 2 118,902,832 (GRCm39) missense possibly damaging 0.73
R4870:Knl1 UTSW 2 118,911,994 (GRCm39) missense probably benign 0.22
R4935:Knl1 UTSW 2 118,899,438 (GRCm39) missense possibly damaging 0.50
R5167:Knl1 UTSW 2 118,900,512 (GRCm39) missense probably damaging 1.00
R5184:Knl1 UTSW 2 118,899,657 (GRCm39) missense probably damaging 1.00
R5293:Knl1 UTSW 2 118,900,176 (GRCm39) missense probably damaging 0.99
R5326:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.66
R5331:Knl1 UTSW 2 118,900,736 (GRCm39) missense possibly damaging 0.92
R5353:Knl1 UTSW 2 118,901,464 (GRCm39) missense probably benign 0.01
R5493:Knl1 UTSW 2 118,899,211 (GRCm39) missense probably damaging 0.98
R5542:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.66
R5632:Knl1 UTSW 2 118,900,833 (GRCm39) missense probably damaging 1.00
R5650:Knl1 UTSW 2 118,912,031 (GRCm39) nonsense probably null
R5854:Knl1 UTSW 2 118,900,884 (GRCm39) missense probably benign 0.02
R5979:Knl1 UTSW 2 118,899,841 (GRCm39) missense possibly damaging 0.83
R6086:Knl1 UTSW 2 118,924,549 (GRCm39) missense probably damaging 1.00
R6283:Knl1 UTSW 2 118,900,767 (GRCm39) missense probably damaging 1.00
R6285:Knl1 UTSW 2 118,902,422 (GRCm39) missense probably damaging 1.00
R6419:Knl1 UTSW 2 118,899,484 (GRCm39) missense probably benign 0.02
R6608:Knl1 UTSW 2 118,917,093 (GRCm39) missense probably damaging 0.99
R6881:Knl1 UTSW 2 118,925,665 (GRCm39) missense possibly damaging 0.67
R7161:Knl1 UTSW 2 118,901,266 (GRCm39) missense possibly damaging 0.79
R7206:Knl1 UTSW 2 118,899,780 (GRCm39) missense probably benign 0.35
R7270:Knl1 UTSW 2 118,933,003 (GRCm39) missense possibly damaging 0.53
R7276:Knl1 UTSW 2 118,902,167 (GRCm39) missense probably damaging 0.98
R7358:Knl1 UTSW 2 118,901,040 (GRCm39) missense possibly damaging 0.92
R7402:Knl1 UTSW 2 118,925,707 (GRCm39) nonsense probably null
R7408:Knl1 UTSW 2 118,901,073 (GRCm39) missense possibly damaging 0.54
R7475:Knl1 UTSW 2 118,918,027 (GRCm39) missense probably damaging 1.00
R7516:Knl1 UTSW 2 118,901,179 (GRCm39) missense probably damaging 0.99
R7524:Knl1 UTSW 2 118,896,460 (GRCm39) missense probably damaging 1.00
R7559:Knl1 UTSW 2 118,924,487 (GRCm39) missense possibly damaging 0.84
R7607:Knl1 UTSW 2 118,925,614 (GRCm39) missense possibly damaging 0.93
R7745:Knl1 UTSW 2 118,902,037 (GRCm39) missense probably benign 0.13
R7847:Knl1 UTSW 2 118,901,457 (GRCm39) missense probably benign 0.02
R8423:Knl1 UTSW 2 118,900,513 (GRCm39) missense probably damaging 1.00
R8725:Knl1 UTSW 2 118,899,524 (GRCm39) missense probably benign 0.34
R8727:Knl1 UTSW 2 118,899,524 (GRCm39) missense probably benign 0.34
R8995:Knl1 UTSW 2 118,902,990 (GRCm39) missense probably benign 0.11
R9023:Knl1 UTSW 2 118,900,761 (GRCm39) missense probably benign 0.27
R9100:Knl1 UTSW 2 118,899,469 (GRCm39) missense probably benign 0.02
R9102:Knl1 UTSW 2 118,917,973 (GRCm39) missense probably benign 0.22
R9303:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.83
R9400:Knl1 UTSW 2 118,931,224 (GRCm39) missense probably damaging 0.98
R9426:Knl1 UTSW 2 118,899,979 (GRCm39) missense possibly damaging 0.81
R9583:Knl1 UTSW 2 118,887,782 (GRCm39) missense probably damaging 1.00
R9616:Knl1 UTSW 2 118,907,425 (GRCm39) missense probably damaging 1.00
R9616:Knl1 UTSW 2 118,899,994 (GRCm39) missense probably benign 0.02
R9671:Knl1 UTSW 2 118,901,089 (GRCm39) missense probably damaging 1.00
R9766:Knl1 UTSW 2 118,900,381 (GRCm39) missense probably damaging 1.00
R9782:Knl1 UTSW 2 118,899,910 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTGAAGGCTGATGATAAGTATTC -3'
(R):5'- TGGTGACATTCTTTGATGCTAAGTC -3'

Sequencing Primer
(F):5'- AAAATATGTACCAATCCAGATGCTG -3'
(R):5'- TGATGCTAAGTCAAAAGTTGTAGG -3'
Posted On 2018-08-07