Incidental Mutation 'R6227:Tes3-ps'
ID531235
Institutional Source Beutler Lab
Gene Symbol Tes3-ps
Ensembl Gene ENSMUSG00000113255
Gene Nametestis derived transcript 3, pseudogene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location49493318-49496589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49494040 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 131 (C131R)
Ref Sequence ENSEMBL: ENSMUSP00000152773 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000222404
AA Change: C131R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Tes3-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6876:Tes3-ps UTSW 13 49493719 missense probably benign 0.27
R7447:Tes3-ps UTSW 13 49494032 missense possibly damaging 0.58
R7936:Tes3-ps UTSW 13 49493984 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTAGATACAAAGACCCTCAGGATG -3'
(R):5'- GAAGATTCCACGTGTCTTTTGG -3'

Sequencing Primer
(F):5'- ACCCTCAGGATGAAAATAAAATTGG -3'
(R):5'- TTGATCGTTTATGATGCTCCAAC -3'
Posted On2018-08-07