Incidental Mutation 'R6336:Gbp11'
ID531250
Institutional Source Beutler Lab
Gene Symbol Gbp11
Ensembl Gene ENSMUSG00000092021
Gene Nameguanylate binding protein 11
SynonymsGm7141
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105323042-105346472 bp(-) (GRCm38)
Type of Mutation
DNA Base Change (assembly) A to G at 105325489 bp
ZygosityHeterozygous
Amino Acid Change
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Gbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Gbp11 APN 5 105327616 critical splice acceptor site probably null
IGL01347:Gbp11 APN 5 105331328 splice site probably benign
IGL01762:Gbp11 APN 5 105327607 missense probably benign
IGL02157:Gbp11 APN 5 105327508 missense possibly damaging 0.95
Quilt UTSW 5 105325508 missense probably damaging 1.00
Tilted UTSW 5 105331053 missense probably damaging 1.00
R0550:Gbp11 UTSW 5 105343750 missense probably benign 0.28
R0647:Gbp11 UTSW 5 105330964 missense possibly damaging 0.93
R1530:Gbp11 UTSW 5 105327489 missense probably damaging 0.99
R1612:Gbp11 UTSW 5 105326596 missense possibly damaging 0.72
R1677:Gbp11 UTSW 5 105327411 missense probably damaging 1.00
R1738:Gbp11 UTSW 5 105326644 missense probably benign 0.02
R2063:Gbp11 UTSW 5 105328584 nonsense probably null
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2873:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R3915:Gbp11 UTSW 5 105331112 missense probably damaging 1.00
R4854:Gbp11 UTSW 5 105325508 missense probably damaging 1.00
R5140:Gbp11 UTSW 5 105331053 missense probably damaging 1.00
R5534:Gbp11 UTSW 5 105331038 missense probably damaging 1.00
R6091:Gbp11 UTSW 5 105331388 missense possibly damaging 0.95
R6351:Gbp11 UTSW 5 105327598 missense probably benign 0.07
R6956:Gbp11 UTSW 5 105328375 critical splice donor site probably null
R7371:Gbp11 UTSW 5 105342105 missense probably benign 0.06
R7393:Gbp11 UTSW 5 105327577 missense possibly damaging 0.60
R7410:Gbp11 UTSW 5 105343908 missense probably damaging 1.00
R7443:Gbp11 UTSW 5 105330950 critical splice donor site probably null
R7898:Gbp11 UTSW 5 105324932 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGACCATGCCCATGTGAC -3'
(R):5'- TGAAGAGCTTGGGCCATCTG -3'

Sequencing Primer
(F):5'- TTCCAGGGTGGGCATCC -3'
(R):5'- GCTTGGGCCATCTGCTTGC -3'
Posted On2018-08-17