Incidental Mutation 'R6331:A2ml1'
ID531253
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6331 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128552236 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 981 (D981G)
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably damaging
Transcript: ENSMUST00000060574
AA Change: D981G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: D981G

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,180,514 R228H probably damaging Het
9930021J03Rik C T 19: 29,717,747 V1449I probably benign Het
Abcc1 C A 16: 14,465,056 A1132D probably damaging Het
Adamts12 A G 15: 11,241,433 T364A probably damaging Het
Ahnak A T 19: 9,006,625 M1758L probably benign Het
Ak9 T C 10: 41,382,829 V774A probably damaging Het
Ash1l A G 3: 89,007,865 E1934G probably benign Het
Atp2b2 C T 6: 113,797,131 A341T probably benign Het
Bach2 G T 4: 32,238,816 probably benign Het
Ccdc102a T C 8: 94,911,516 T241A probably benign Het
Chd5 G T 4: 152,382,408 R1627S probably benign Het
Clint1 T C 11: 45,895,081 S322P probably benign Het
Dapk1 T A 13: 60,729,442 C498* probably null Het
Diaph3 T G 14: 86,866,540 S803R probably damaging Het
Dmp1 T C 5: 104,207,125 L10P probably damaging Het
Gcc2 T C 10: 58,271,465 V741A probably benign Het
Gldn A G 9: 54,286,878 M119V probably benign Het
Gucy1b1 A G 3: 82,034,411 S574P possibly damaging Het
Hapln4 T A 8: 70,084,423 probably benign Het
Hars A G 18: 36,771,332 V209A probably benign Het
Htt T A 5: 34,895,887 F2521L possibly damaging Het
Kif14 A G 1: 136,515,986 D1299G probably null Het
Krt25 T A 11: 99,317,427 E325V probably damaging Het
Lcmt1 T C 7: 123,378,182 probably benign Het
Lrp1b A T 2: 40,803,209 N3266K probably damaging Het
Marc2 A G 1: 184,819,328 S304P probably damaging Het
Mctp1 T A 13: 77,020,863 probably null Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Myom3 A G 4: 135,776,377 N379S possibly damaging Het
Nbea A T 3: 56,000,616 D1358E possibly damaging Het
Nod1 T C 6: 54,924,983 E939G probably damaging Het
Obox1 A G 7: 15,555,369 R70G probably benign Het
Olfr1024 T C 2: 85,904,216 I279M probably benign Het
Olfr1239 C T 2: 89,418,351 G21S probably benign Het
Olfr1341 A G 4: 118,709,947 E180G probably benign Het
Olfr272 A G 4: 52,911,399 Y132H probably damaging Het
Otof T C 5: 30,371,935 D1745G possibly damaging Het
Pklr A G 3: 89,137,355 I47V probably damaging Het
Pms2 T A 5: 143,914,633 S123T possibly damaging Het
Pnpla2 T C 7: 141,459,285 S337P probably damaging Het
Ptgfrn A C 3: 101,045,620 V766G possibly damaging Het
Ptpn11 T A 5: 121,144,653 H419L probably damaging Het
Rims3 T A 4: 120,883,153 V99E probably damaging Het
Samd9l A G 6: 3,376,361 V300A probably damaging Het
Sdad1 T C 5: 92,303,930 D144G probably damaging Het
Siglecg T C 7: 43,408,754 Y22H possibly damaging Het
Slc39a1 A G 3: 90,252,281 K305R possibly damaging Het
Slc5a4a A G 10: 76,178,200 R414G probably damaging Het
Smg1 T C 7: 118,154,277 probably benign Het
Tbc1d9b C T 11: 50,131,497 A20V possibly damaging Het
Tgfb3 G T 12: 86,063,864 D237E probably benign Het
Tle6 A G 10: 81,595,239 S234P probably benign Het
Tnrc6b A G 15: 80,879,614 N439S probably benign Het
Trim33 T C 3: 103,341,609 S783P probably benign Het
Ttn A T 2: 76,802,354 Y12373N probably damaging Het
Tube1 G A 10: 39,134,101 V7I probably benign Het
Tufm T C 7: 126,489,238 V265A probably benign Het
Uhrf1bp1 T C 17: 27,893,201 I1150T probably benign Het
Usp32 T C 11: 84,986,576 H1550R possibly damaging Het
Usp33 A T 3: 152,376,250 M546L probably damaging Het
Uspl1 C A 5: 149,214,287 Q752K probably benign Het
Vmn1r20 A G 6: 57,431,670 probably null Het
Vmn1r201 T C 13: 22,475,351 F245S probably damaging Het
Vmn2r3 A G 3: 64,278,761 S168P probably damaging Het
Wdr24 T G 17: 25,825,676 D168E possibly damaging Het
Zfp646 C T 7: 127,883,681 P1677S probably damaging Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128546448 missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2062:A2ml1 UTSW 6 128552308 missense probably benign 0.08
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3785:A2ml1 UTSW 6 128544924 critical splice donor site probably null
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128554361 missense probably benign 0.05
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 unclassified probably null
R6465:A2ml1 UTSW 6 128541078 missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R6793:A2ml1 UTSW 6 128546329 nonsense probably null
R7207:A2ml1 UTSW 6 128550771 missense probably benign 0.04
R7378:A2ml1 UTSW 6 128546247 critical splice donor site probably null
R7556:A2ml1 UTSW 6 128569964 missense probably damaging 1.00
R8010:A2ml1 UTSW 6 128580340 missense probably benign 0.08
R8017:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8019:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8035:A2ml1 UTSW 6 128553280 missense probably damaging 0.99
R8094:A2ml1 UTSW 6 128572082 missense probably damaging 1.00
R8144:A2ml1 UTSW 6 128569999 missense possibly damaging 0.84
RF014:A2ml1 UTSW 6 128570068 missense probably damaging 0.96
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Z1176:A2ml1 UTSW 6 128571977 missense probably benign 0.09
Z1177:A2ml1 UTSW 6 128545076 missense probably benign
Z1177:A2ml1 UTSW 6 128561616 nonsense probably null
Z1177:A2ml1 UTSW 6 128575607 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACAGCTAGGATTCAGAGGACC -3'
(R):5'- AAATGATTTCCTATTCCCACCATGC -3'

Sequencing Primer
(F):5'- CTAGGATTCAGAGGACCTAAATGTC -3'
(R):5'- ACCATGCCCTGCGGTTATTAG -3'
Posted On2018-08-17