Incidental Mutation 'R6369:Rad52'
ID531256
Institutional Source Beutler Lab
Gene Symbol Rad52
Ensembl Gene ENSMUSG00000030166
Gene NameRAD52 homolog, DNA repair protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location119902698-119922828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119914207 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 76 (E76G)
Ref Sequence ENSEMBL: ENSMUSP00000125559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032269] [ENSMUST00000161045] [ENSMUST00000162461]
Predicted Effect silent
Transcript: ENSMUST00000032269
SMART Domains Protein: ENSMUSP00000032269
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 36 185 2.4e-56 PFAM
low complexity region 262 276 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161045
AA Change: E76G
SMART Domains Protein: ENSMUSP00000125559
Gene: ENSMUSG00000030166
AA Change: E76G

DomainStartEndE-ValueType
PDB:1H2I|V 1 64 2e-26 PDB
Predicted Effect silent
Transcript: ENSMUST00000162461
SMART Domains Protein: ENSMUSP00000125502
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 36 184 6.6e-51 PFAM
low complexity region 262 276 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51 related DNA recombination and repair. A pseudogene of this gene is present on chromosome 2. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit normal reproductive and immune systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Rad52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Rad52 APN 6 119918633 missense probably damaging 1.00
IGL02376:Rad52 APN 6 119915230 splice site probably benign
IGL02572:Rad52 APN 6 119915227 splice site probably benign
IGL03292:Rad52 APN 6 119918973 missense possibly damaging 0.96
R1693:Rad52 UTSW 6 119916035 missense probably damaging 1.00
R2076:Rad52 UTSW 6 119911079 missense probably benign 0.39
R2110:Rad52 UTSW 6 119920894 missense possibly damaging 0.80
R4753:Rad52 UTSW 6 119912985 intron probably benign
R5857:Rad52 UTSW 6 119911007 intron probably null
R5866:Rad52 UTSW 6 119912946 intron probably benign
R6193:Rad52 UTSW 6 119920182 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCACCCAGCAAAATGTGGG -3'
(R):5'- CTTTCTACAGATGAGGGGCAG -3'

Sequencing Primer
(F):5'- CCCAGCAAAATGTGGGTATGTTTC -3'
(R):5'- GATGAGCAAGGATGTTTGAATACTGC -3'
Posted On2018-08-17