Incidental Mutation 'R6289:Katnal2'
ID531261
Institutional Source Beutler Lab
Gene Symbol Katnal2
Ensembl Gene ENSMUSG00000025420
Gene Namekatanin p60 subunit A-like 2
Synonyms4933439B08Rik, 3110023G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location76977148-77047308 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 77017455 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026486] [ENSMUST00000126153] [ENSMUST00000137498] [ENSMUST00000154665]
Predicted Effect probably null
Transcript: ENSMUST00000026486
SMART Domains Protein: ENSMUSP00000026486
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 400 6.46e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126153
SMART Domains Protein: ENSMUSP00000122079
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 425 1.74e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137498
SMART Domains Protein: ENSMUSP00000117495
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
AAA 243 381 1.74e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154665
SMART Domains Protein: ENSMUSP00000119066
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Katnal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Katnal2 APN 18 77002754 missense probably damaging 1.00
IGL00976:Katnal2 APN 18 77017493 missense probably damaging 1.00
IGL01012:Katnal2 APN 18 77017554 missense probably damaging 0.96
IGL01302:Katnal2 APN 18 77047167 splice site probably benign
IGL01377:Katnal2 APN 18 77002457 missense probably damaging 1.00
IGL01532:Katnal2 APN 18 77012000 missense probably benign
IGL03203:Katnal2 APN 18 77007524 missense probably damaging 1.00
R0592:Katnal2 UTSW 18 77002560 splice site probably null
R1348:Katnal2 UTSW 18 76978542 splice site probably null
R1419:Katnal2 UTSW 18 76977432 missense possibly damaging 0.85
R1755:Katnal2 UTSW 18 77012067 missense probably benign 0.01
R1772:Katnal2 UTSW 18 77002537 missense probably damaging 1.00
R1852:Katnal2 UTSW 18 77016023 missense probably benign 0.08
R1952:Katnal2 UTSW 18 76980011 missense probably benign 0.00
R2115:Katnal2 UTSW 18 76980091 missense probably damaging 1.00
R2155:Katnal2 UTSW 18 77010941 missense probably benign 0.01
R4765:Katnal2 UTSW 18 76977543 splice site probably null
R5126:Katnal2 UTSW 18 77017598 missense probably benign 0.13
R5141:Katnal2 UTSW 18 76997641 missense probably damaging 1.00
R5315:Katnal2 UTSW 18 77012009 missense probably benign 0.02
R5358:Katnal2 UTSW 18 77017494 missense possibly damaging 0.47
R5412:Katnal2 UTSW 18 77002435 missense probably damaging 1.00
R6647:Katnal2 UTSW 18 76980037 missense probably benign 0.01
R6919:Katnal2 UTSW 18 77011038 missense probably benign 0.05
R7039:Katnal2 UTSW 18 77047172 critical splice donor site probably null
R7285:Katnal2 UTSW 18 76993575 missense probably benign 0.20
Z1176:Katnal2 UTSW 18 77012057 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCTACTCTTCCAGGCATG -3'
(R):5'- TCTCCTGTAAAACTGCCAGC -3'

Sequencing Primer
(F):5'- GAACCAATCAACCATGAGCCTAGG -3'
(R):5'- ACTGCCAGCTACATGGATG -3'
Posted On2018-08-21