Incidental Mutation 'R6348:Hsd3b3'
ID531267
Institutional Source Beutler Lab
Gene Symbol Hsd3b3
Ensembl Gene ENSMUSG00000062410
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6348 (G1)
Quality Score97.0078
Status Validated
Chromosome3
Chromosomal Location98741523-98763127 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 98755949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146196]
Predicted Effect probably null
Transcript: ENSMUST00000146196
SMART Domains Protein: ENSMUSP00000121360
Gene: ENSMUSG00000062410

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 174 1.9e-7 PFAM
Pfam:adh_short 5 133 5.6e-9 PFAM
Pfam:KR 5 133 9.5e-8 PFAM
Pfam:Polysacc_synt_2 6 135 2.8e-14 PFAM
Pfam:NmrA 6 137 1.8e-9 PFAM
Pfam:Epimerase 6 187 2.2e-23 PFAM
Pfam:NAD_binding_10 6 187 1.4e-10 PFAM
Pfam:3Beta_HSD 7 187 9.3e-76 PFAM
Pfam:NAD_binding_4 8 176 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Hsd3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Hsd3b3 APN 3 98741900 missense probably benign 0.09
IGL01776:Hsd3b3 APN 3 98743847 missense probably benign 0.05
IGL02189:Hsd3b3 APN 3 98742138 missense probably benign
R0689:Hsd3b3 UTSW 3 98741979 missense possibly damaging 0.76
R0893:Hsd3b3 UTSW 3 98742441 unclassified probably null
R1759:Hsd3b3 UTSW 3 98742083 missense probably damaging 0.96
R2008:Hsd3b3 UTSW 3 98742092 missense probably damaging 1.00
R3931:Hsd3b3 UTSW 3 98742176 missense probably damaging 1.00
R4614:Hsd3b3 UTSW 3 98742080 missense probably benign 0.03
R4664:Hsd3b3 UTSW 3 98742216 missense probably damaging 1.00
R4749:Hsd3b3 UTSW 3 98742615 missense probably damaging 1.00
R4766:Hsd3b3 UTSW 3 98742485 missense probably damaging 1.00
R4876:Hsd3b3 UTSW 3 98742644 missense probably damaging 1.00
R5074:Hsd3b3 UTSW 3 98742024 missense possibly damaging 0.94
R5622:Hsd3b3 UTSW 3 98742208 missense possibly damaging 0.79
R6280:Hsd3b3 UTSW 3 98753305 splice site probably null
R7070:Hsd3b3 UTSW 3 98742471 missense possibly damaging 0.64
R7283:Hsd3b3 UTSW 3 98742357 nonsense probably null
R7747:Hsd3b3 UTSW 3 98743898 missense possibly damaging 0.76
R8054:Hsd3b3 UTSW 3 98742015 missense probably damaging 1.00
Z1176:Hsd3b3 UTSW 3 98743960 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGTTTTAATAAGGGGCCACTATC -3'
(R):5'- TCTGAGTTGATTGAAAGTGCTGAC -3'

Sequencing Primer
(F):5'- TTTTAATAAGGGGCCACTATCATAAC -3'
(R):5'- TGCTGACACTGCTGCTG -3'
Posted On2018-08-27