Incidental Mutation 'R6776:1500015O10Rik'
ID 531270
Institutional Source Beutler Lab
Gene Symbol 1500015O10Rik
Ensembl Gene ENSMUSG00000026051
Gene Name RIKEN cDNA 1500015O10 gene
Synonyms Ecrg4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6776 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 43730602-43742578 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 43742391 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 144 (N144K)
Ref Sequence ENSEMBL: ENSMUSP00000027217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027217] [ENSMUST00000126008]
AlphaFold Q99LS0
Predicted Effect probably damaging
Transcript: ENSMUST00000027217
AA Change: N144K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027217
Gene: ENSMUSG00000026051
AA Change: N144K

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Augurin 32 148 2.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126008
SMART Domains Protein: ENSMUSP00000119939
Gene: ENSMUSG00000057363

DomainStartEndE-ValueType
Pfam:UXS1_N 4 78 2.3e-40 PFAM
Pfam:RmlD_sub_bind 89 370 1.1e-11 PFAM
Pfam:Polysacc_synt_2 91 207 2.7e-6 PFAM
Pfam:Epimerase 91 324 9.8e-52 PFAM
Pfam:3Beta_HSD 92 305 1.8e-9 PFAM
Pfam:GDP_Man_Dehyd 92 387 1.3e-58 PFAM
Pfam:NAD_binding_4 129 297 4.7e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: No notable pheontype was detected in high throughput screens of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc11a1 T A 1: 74,384,085 I365N probably damaging Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in 1500015O10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:1500015O10Rik APN 1 43730951 missense probably damaging 0.99
R0543:1500015O10Rik UTSW 1 43742289 missense possibly damaging 0.95
R2149:1500015O10Rik UTSW 1 43742336 missense probably damaging 1.00
R4621:1500015O10Rik UTSW 1 43737252 splice site probably null
R4622:1500015O10Rik UTSW 1 43742321 missense possibly damaging 0.79
R5940:1500015O10Rik UTSW 1 43737241 nonsense probably null
R6648:1500015O10Rik UTSW 1 43738691 missense probably damaging 1.00
RF007:1500015O10Rik UTSW 1 43737192 critical splice acceptor site probably benign
RF045:1500015O10Rik UTSW 1 43737192 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TCACTGAGAAAAGCCACAGTTTC -3'
(R):5'- CCAAGTGAATTCTGATGCTTCTCTC -3'

Sequencing Primer
(F):5'- GGATTATGTGTCTTCAAAACCATCC -3'
(R):5'- TCGTTAAGCACATGCATG -3'
Posted On 2018-08-29